In economics, especially econometrics, fixed-effects are widely recognized as powerful tools for heterogeneity analysis of longitudinal data sets. However, the existing research pays more attention to such as the variable selection, parameter estimation and dimension reduction on linear relationships with too many assumptions while nonlinear relationships are ubiquitous. In this paper, an extension fixed-effects model is proposed on the curve_fit nonlinear least squares. First, with the help of expert knowledge, the series regressions between independent variables including time and dependent variable is estimated on each series data, and the parameters are estimated by curve_fit. Similarly, the coeffection between independent variables including time and dependent variable is also initially estimated on the whole panel data. Second, the distance between regressions is defined, and then the coeffect function between the series regressions is obtained on the initial co-effect with curve_fit. Third, the time-effects and individual fixed-effects for each series data in the panel data are estimated on the differences of series regressions and co-effect function. Additionally, the effectiveness of the proposed method is varified on the synthetic data.

This paper reviews the multiple roles of machine learning in improving the resilience of power grids, especially in applying new energy storage technologies. Energy storage technologies, such as compressed air energy storage, flywheel energy storage, and superconducting coil energy storage, significantly improve the power grid's ability to respond to load fluctuations and emergencies through intelligent control and optimisation of machine learning algorithms. This not only helps to optimise energy dispatch and improve the operational efficiency and flexibility of the grid but also significantly improves the stability and reliability of the grid so that it is better able to meet future challenges and needs.

Oxidation of a mixture of nonlabelled (14N2H4) and 15N labeled (15N2H4) hydrazine in aqueous solutions produces 14N15N molecules, indicating the intermediate existence of N4H6 or N4H4 dimers with subsequent transfers of H atoms and splitting of lateral N-N bonds. To explain the key part of hydrazine oxidation reaction, the structures, thermodynamics, and electron characteristics of N4H4 molecules in aqueous solution are investigated at CCSD/cc-pVTZ level of theory. We have not found any spontaneous splitting of the bond between lateral nitrogen atoms in tetrazenes N4H4 during geometry optimization. The most probable N4H4 oxidation products are H2N-NH2 and N2, which are obtained by splitting the bond between central nitrogen atoms and so only 15N2 and 14N2 molecules are formed. Additionally, the formation of H3N-NH and N2 oxidation products is also preferred to structures without any N-N fissions. The formation of H2N=N and HN=NH reaction products is energetically less advantageous. Cyclo-N4H4 structures are stable, without any N-N fissions, but their very high Gibbs energies indicate their vanishing abundance in aqueous solution, so their involvement in hydrazine oxidation is highly improbable. Hydrazine oxidation to 14N15N molecules cannot be explained by tetrazene N4H4 intermediates.

Considering that emotional events diversify as one ages, this study formulates the Salient Episodic Memory Aggregation Hypothesis, which claims that aging induces homogenization of episodic memory and consequently increases the salience of emotional episodes. To test this hypothesis, the study focused on sadness episodic memory and conducted a web-based survey and a combined analysis consisting of natural language processing, machine learning, and network graph analysis. A sample of 2,954 adults aged between their 20s and over 70s participated in this study. They were asked to describe a sad event they had experienced and assess the psychological properties of the recalled episodes. After isolating and lemmatizing episodic words using natural language processing, vocabulary frequency was counted for each generation, and network graph analysis based on machine learning was performed to compare the structures of sadness episodes between generations. As a result, there were mainly two types of episodic words for which frequencies either declined or increased with age. The network structures of episodic words for the older generations possessed higher proximity (shortest path length) to higher concentrations of episodic words. These findings support the current hypothesis, indicating that the nature of sadness episodes differ between generations, and that older people have more aggregated episodic memory structures.

An information-theoretic data mining method is employed to analyze categorical spatiotemporal Geographic Information System land use data. Reconstructability Analysis (RA) is a maximum-entropy-based data modeling methodology that works exclusively with discrete data such as those in the National Land Cover Database (NLCD). The NLCD are organized into a spatial (raster) grid, and are available in consistent format for every five years from 2001 to 2021. An NLCD tool reports how much change occurred for each category of land use; for the study area examined the most dynamic class is Evergreen Forest (EFO), so the presence or absence of EFO in 2021 was chosen as the dependent variable that our data modeling attempts to predict. RA predicts the outcome with approximately 80% accuracy using a sparse set of cells from a spacetime data cube consisting of neighboring lagged-time cells. When the predicting cells are all Shrubs & Grasses there is a high probability for a 2021 state of EFO, while when the predicting cells are all EFO, there is a high probability that the 2021 state will be not-EFO. These findings are interpreted as detecting forest clear-cut cycles that show up in the data, and explain why this class is so dynamic. This study introduces a new approach to analyzing GIS categorical data and expands the range of applications that this entropy-based methodology can successfully model.

Interoperable multilayer networks are pivotal and transformative in public digital health. They not only enhance the delivery of healthcare services but also contribute significantly to improving public health outcomes. Through better accessibility, efficiency, and data-driven decision-making, these networks are revolutionizing how we approach public health. The seamless data exchange and integration they facilitate across different healthcare systems and providers can lead to substantial cost savings for public healthcare systems. These networks pave the way for a more efficient and effective healthcare system by reducing redundancies, optimizing resource allocation, and minimizing unnecessary procedures. This study combines the pressing issues of public digital health with the innovative interpretation of multilayer network theory, proposing practical solutions that inspire academics and practitioners alike.Public digital health is not just about improving care access and patient engagement. It is also about ensuring the financial sustainability of our healthcare systems. Innovative multilayer network analysis is critical in this game, improving interoperability and reducing spatial and temporal constraints. These networks streamline processes and improve efficiency by easing complex interactions within healthcare systems. This process, in turn, allows healthcare providers to deliver high-quality care at a lower cost, transforming, whenever possible, in-patients and out-patients into home-patients. Networks are a cornerstone and a beacon of hope for transforming public digital health. They are increasing the Value for Money and enhancing a patient-centric approach, making us optimistic about the future of healthcare.This study shows that revolutionizing digital healthcare methodologies has a profound impact on crucial elements like resilience, interoperability, and patient well-being within public health. The enhancement of interoperability facilitates the smooth flow of data exchange across various platforms and healthcare providers, fostering improved collaboration and decision-making processes and elevating the safety of patients.

Online food delivery services are rapidly growing in popularity, making customer satisfaction critical for company success in a competitive market. Accurate delivery time predictions are key to ensuring high customer satisfaction. While various methods for travel time estimation exist, effective data analysis and processing are often overlooked. This paper addresses this gap by leveraging spatial data analysis and preprocessing techniques to enhance the data quality used in Bayesian models for predicting food delivery times. We utilized the OSRM API to generate routes that accurately reflect real-world conditions. Next, we visualized these routes using various techniques to identify and examine suspicious results. Our analysis of route distribution identified two groups of outliers, leading us to establish an appropriate boundary for maximum route distance to be used in future Bayesian modelling. The spatial analysis revealed that these outliers were primarily deliveries to the outskirts or beyond the city limits. By refining the data quality through these methods, we aim to improve the accuracy of delivery time predictions, ultimately enhancing customer satisfaction.

An increasing need for better agricultural practices that are sustainable to provide increased yields of crops for the ever increasing food demand to be met for the growing world population is a current necessity. It is estimated by the UN that in 2050 the world’s populace may be as much as 9.8 billion global, yet, farmers still face several obstacles, which includes soil degradation, extreme temperatures, and drought which as increasingly becoming more severe with climate changes. Plant health monitoring is a method that will help to increase awareness about plant enhancing by studying how to increase crop yields while decreasing the environmental impacts. The use of low-cost, controlled environments, soil quality, water levels, and pathogenic and pests attacks can be regularly monitored. Currently, several diagnostic technologies and portable point-of-use methods and technologies are employed for detection of diseases, although, the current available lab-based methods used for plant’s diagnostics test are inadequate for plant point-of-use monitoring. The promotion of use of these point of use methods will enable pathogen detection, poor plant growth, unsuitable environmental conditions and nutrient use efficiency allowing for immediate and timely corrective actions to ensure minimal damage to the plants with maximal yield. Increase in the use of sustainable agri practices are required for ensuring higher yields with minimal inputs and that are non-destructive to the land and the use of improved methodologies and technologies will be useful tools for achieving sustainable agriculture.

Insulin-like Growth Factor 2 mRNA binding Protein 1 (IGF2BP1) is a promising candidate gene for influencing economic traits in livestock and poultry. The second intronic region of IGF2BP1 is closely related to growth traits, although the exact mechanism remains unclear. The preliminary resequencing results of goats in our laboratory demonstrated that the IGF2BP1 gene region was subject to strong selection, then we selected multiple single nucleotide polymorphisms (SNPs) to identify. Seven SNPs were located in the conserved region of the second intron, and their functions and relationship with growth traits require further clarification. This study selected 348 Nanjiang Yellow goats as experimental subjects, and chose Time of Flight Mass Spectrometer (MALDI-TOF) as the main method. Our results showed that six SNPs were significantly correlated with the growth traits of the Nanjiang yellow goat by association analysis. Among them, the rs652062749(A>G) was identified as the primary locus affecting the later stage of growth traits of Nanjiang yellow goat. Moreover, there was a strong linkage among three SNPs, and the rs638185407 (T>A) mutant type was observed to increase the luciferase activity in H293T cells extremely significantly. The TTAACT, TTCCCC, and ATCACT combination genotypes were dominant combination genotypes, which provided theoretical references for further genetic co-breeding. The results of our study demonstrate the potential role of the IGF2BP1 gene as a functional genetic marker in the breeding programs of Nanjiang Yellow goats.

The increasing concern regarding climate change continues to motivate research in the Arctic. Within the delicate cycle of the cryosphere, leads are an important kinematic feature that regulate heat balances in the Arctic. Therefore, it is necessary to quantify the genesis of leads over time to identify when and where changes are occurring. The use of a principal component analysis (PCA) is one such tool that is used to identify the characteristics of seasonal ice variability. The PCA not only identifies “normal” or “dominant” conditions or features, but also extract anomalous spatial features from an archive of long-term sequence of images.

Robot manipulators are robotic systems that are frequently used in automation systems and able to provide increased speed, precision and efficiency in the industrial applications. Due to their nonlinear and complex nature, it is crucial to optimize the robot manipulator systems in terms of trajectory control. In this study, positioning analysis based on artificial neural networks (ANN) were performed for robot manipulator systems used in the textile industry and the optimal ANN model for the high-accuracy positioning was improved. The inverse kinematic analysis of a 6 degree of freedom (DOF) industrial denim robot manipulator were carried out via 4 different learning algorithms of Delta-Bar-Delta (DBD), Online Back Propagation (OBP), Quick Back Propagation (QBP) and Random Back Propagation (RBP) for proposed neural network predictor. From the results obtained, it was observed that QBP based 3-10-6 type ANN structure produced the optimal results in terms of estimation and modelling of trajectory control. In addition, 3-5-6 type ANN structure was also improved and its Root Mean Square Error (RMSE) and statistical R2 performances were compared to that of 3-10-6 ANN structure. Consequently, it can be concluded that the proposed neural predictors can successfully be employed in real-time industrial applications for robot manipulator trajectory analysis.

Financial statements depict the condition of a company and need to be analyzed and evaluated to assess its performance. This research aims to analyze financial statements to describe the financial condition, measure business development over time, and evaluate the achievement of the com-pany's objectives. An optimization analysis of financial ratios is performed using the Weighted Goal Programming (WGP) model, which addresses multiple objectives by applying weights based on their priorities. The Analytical Hierarchy Process was used to determine the priority weights of deviation variables from each financial ratio target. Financial ratios were selected based on their impact on profit using factor analysis. The constructed WGP model aims to minimize deviations in Return on Assets, Operating Ratios, Operating Income Ratio, Total Assets Turnover, and Current Ratio. Computational calculations to solve the WGP model are per-formed using Python, with pseudocode provided. A case study on a company in the garment and textile sector was conducted and found that the Operating Ratio, Return on Assets, Operating Income Ratio, and Current Ratio still need improvement by developing strategies to achieve the targets. Sensitivity analysis was also employed to assess the resilience of the model in response to alterations in data.

The cooling of server components has been continuously developed over the past few years in order to meet the increasing cooling requirements of server component manufacturers such as for the processor chips. The growth in performance and power density increases the cooling demand. These requirements directly influence the energy consumption and performance of the hardware. To gain a better understanding of the historical evolution and possible future technology development paths in the field of data center cooling, a patent analysis method was used. The focus is on previous and current development priorities and possible research gaps within the server and computer room levels. The European patent database was selected as data source. To determine relevant patents, the search terms for various cooling technologies were developed iteratively. After the patent extraction for the period 2000 - 2023 (earliest priority year), the search results were classified and analysed. Most of the patents deal with air or liquid cooling. In the area of liquid cooling, the focus was on direct liquid cooling, followed by total liquid cooling. Since 2015 a technological shift from air to liquid cooling can be identified on the level of patent activities. In this context, the patent groups with focus on “constructional details for different types of electric apparatus” and “electrical digital data processing” have the largest share of patents. In addition, the technology focus of the TOP 10 patent applicants was in the field of liquid cooling. In conclusion from the patent analysis, it can be derived that liquid cooling will continue to gain in importance in the future and could also be combined with other approaches in the form of hybrid cooling. However air cooling may still be relevant, even if the main cooling load is handled by liquid-based approaches. At the same time, the optimisation potential for air cooling seems to have been largely exploited in comparison to liquid cooling, as can be seen from the falling number of the patent applications.

The pyrolysis process has emerged as an attractive option for waste treatment. In this technology, inorganic compounds play catalytic effects in the pyrolytic reaction of organic materials, increa-sing the char's yield, porosity, and physicochemical properties. The present research investigates and compares the slow pyrolysis of spent coffee grounds (SCG) using potassium hydroxide (KOH) (weight ratio of 1:1) and landfill leachate membrane concentrate (LLMC) residue (weight ratio of 1:1) as pyrolitic additives. We hypothesized that the high content of alkali and alkaline earth metals in LLMC could enhance the yield or improve the quality of the carbon-based material produced in pyrolysis. This strategy could be a sustainable alternative for valorizing SCG and landfill wastes, replacing catalyzing agents such as steam, CO2, and chemical additives used on an industrial scale. The char yields in slow pyrolysis ranged from 18 to 24%. The SCG had a low specific surface area (4.5 m2 g-1), contrasting with the notable surface areas observed in both ac-tivated chars. In particular, the KOH-activated char displayed a higher surface area than the LLMC-activated char (1960 vs. 1130 m2 g-1). On the other hand, the combustion enthalpy of the LLMC-activated material was estimated at 22 MJ kg-1. This value was 22% higher than the energy enthalpy of SCG and KOH-activated char used for comparison. Our findings confirm that pyrolysis of SCG with KOH produces a microporous material with a high specific surface area. In contrast, the resulting LLMC-activated char demonstrates a higher calorific value. Our findings could contribute to establishing potential industrial applications for SCG and LLMC residues to produce energy and high-value materials.

Securing the structural safety of blades has become crucial, owing to the increasing size and weight of blades resulting from the recent development of large wind turbines. Composites are primarily used for blade manufacturing because of their high specific strength and specific stiff-ness. However, in composite blades, joints may experience fractures from the loads generated during wind turbine operation, leading to deformation caused by changes in the structural stiff-ness. In this study, 7,132 debonding damage data, classified by damage type, position, and size, are selected to predict debonding damage based on natural frequency. The change in the natural frequency caused by debonding damage is acquired through finite element (FE) modeling and modal analysis. Synchronization between the FE analysis model and manufactured blades is achieved through modal testing and data analysis. Finally, the relationship between the debond-ing damage and the change in natural frequency is examined using artificial neural network techniques

Fused deposition modeling (FDM) is widely applied in various fields due to its affordability and ease of use. However, it faces challenges such as achieving high surface quality, precise dimensional tolerance and overcoming anisotropic mechanical properties. This paper analyzes and compare the machinability of 3D printed PLA, PETG and carbon fiber reinforced PETG focusing on surface roughness and burr formation. A design of experiments (DoE) with a full factorial design was used, considering three factors: rotation speed, feed rate and depth of cut. Each factor had different levels: rotational speed at 3000, 5500 and 8000 rpm; feed rate at 400, 600 and 800 mm/min; and depth of cut at 0.2, 0.4, 0.6, and 0.8 mm. Machinability was evaluated by roughness and burr height using a profilometer for all the materials under the same milling conditions. To evaluate the statistical significance of the influence of various processing parameters on surface roughness and burr formation in 3D printed components made of three different materials PLA, PETG and carbon fiber reinforced PETG, an analysis of variance (ANOVA) test was conducted. This analysis investigated whether variations in rotational speed, feed rate and depth of cut resulted in measurable and significant differences in machinability results. Results showed that milling parameters significantly affect roughness and burr formation, with optimal conditions for minimizing any misalignment highlighting the trade-offs in parameter selection. These results provide insights into the post-processing of FDM-printed materials with milling, indicating the need for a balanced approach to parameter selection based on application-specific requirements.

Background: GaitSmart (GS) is a sensor-based digital medical device that can be used with the integrated app vGym to provide a personalised rehabilitation programme for older people undergoing total hip arthroplasty (THA) or total knee arthroplasty (TKA). This study aimed to determine whether the GS intervention used in the rehabilitation of older people undergoing THA or TKA is potentially cost-effective compared to the current standard of care (SoC). Methods: Decision-analytic modelling was conducted to estimate cost-effectiveness over a seventeen- week time horizon, from an NHS perspective. UK clinical and cost data from the GaitSmart randomised clinical trial was used to obtain input parameters, and sensitivity analysis was performed to address uncertainty. Results: Over a seventeen-week time horizon, GS incurred cost savings of £450.56 and a 0.02 gain in quality-adjusted life years (QALYs) compared to the SoC. These results indicate that GS is the dominant intervention because the device demonstrated greater effectiveness and lower costs. Probabilistic sensitivity analyses confirm the robustness of our results. Conclusion: GS appears to offer short-term efficiency benefits and demonstrates cost-effectiveness for the improvement of gait in people undergoing THA or TKA, compared to the SoC. These findings provided new evidence to inform policymakers.

With opioid overdose rates on the rise, we aim to develop a county-level risk stratification, specifically focusing on access to Medications for Opioid Use Disorder (MOUD) and high overdose rates. We examined over 15 million records from the South Carolina Prescription Tracking System (SCRIPTS) across 46 counties. Additionally, we incorporated data from opioid treatment programs, healthcare professionals prescribing naltrexone, clinicians with buprenorphine waivers, and county-level overdose fatality statistics. To assess the risk of opioid misuse, we classified counties into high-risk and low-risk categories based on prescription rates, overdose fatalities, and treatment service availability. Utilizing statistical methods, we compared prescription patterns and outcomes between these groups. Our study shows that between 2017 and 2021, opioid prescriptions decreased from 64,223 to 41,214 per 100,000 residents, while fentanyl-related overdose deaths increased by 312%. High-risk counties have significantly higher rates of fentanyl prescriptions and rely more on out-of-state doctors. They also exhibit higher instances of doctor shopping and had fewer medical doctors per capita, with limited access to MOUD. To effectively combat the opioid crisis, we advocate for improved local healthcare infrastructure, broader treatment access, stricter management of out-of-state prescriptions, and vigilant tracking of prescription patterns. Tailored local strategies are essential for mitigating the opioid epidemic in these communities.

The challenge of missing data in scientific research prompts researchers to decide between imputing incomplete data or discarding observations, where discarding can lead to information loss. Various methods exist, from simple deletion to sophisticated approaches like Multiple Imputation (MI). However, these methods often fall short with high-dimensional datasets. Multiple Imputation by Chained Equations (MICE) and Random Forest (RF) proximity imputation offer promising alternatives. Therefore, in this paper, we propose integrating MICE with Bayesian random forest (BRF) to enhance imputation accuracy and predictive power, particularly in high-dimensional analyses. Our approach combines MICE’s efficiency with BRF’s robustness, offering a comprehensive solution to missing data challenges. By way of example, we provide empirical evaluations to validate its effectiveness using synthetic data of various missing data scenarios. The results from the simulations showed that the combination of BRF and MICE offered a promising strategy for high-dimensional analysis in the presence of missing data.

The intelligent elderly care model places new demands on the skills of aging caregivers. The identification and development of forward-thinking, high-potential nursing talent is essential for advancing the intelligent elderly care sector. Multi-benchmarking selection and competitive analysis is used to evaluate and identify nursing personnel in the rehabilitation treatment center of a hospital in Hefei City. Using proxy evaluation and democratic evaluation model, three types of benchmarks such as single item benchmark, individual benchmark and group benchmark were identified and selected, and the professional nursing team was constructed based on the evaluation results. Different from the traditional other-directed evaluation, multi-benchmarking selection and competitive analysis is self-directed evaluation, this method is more conducive to the identification of high-potential and digital nursing talents by intelligent elderly service organizations, and facilitates the formation of professional nursing teams with complementary strengths and cross-fertilization, so as to satisfy the diversified and multi-level needs of the elderly for intelligent elderly services.

Quantum computing represents a paradigm shift in computational power, promising exponential speedups for solving certain classes of problems. However, harnessing the full potential of quantum computers requires effective utilization of data science techniques. In this review paper, we explore the intersection of data science and quantum computing, focusing on the role of data analytics in advancing quantum computing applications. We begin with an overview of quantum computing fundamentals, including quantum mechanics principles and quantum algorithms. We then delve into topics such as quantum data representation, manipulation, and machine learning algorithms tailored for quantum computing environments. Additionally, we discuss quantum error correction and noise mitigation strategies essential for reliable quantum computation. Furthermore, we survey the landscape of quantum software development tools and frameworks, highlighting their importance in facilitating quantum algorithm design and optimization. Through case studies and examples, we demonstrate the practical applications of data science techniques in quantum computing, including quantum cryptography and quantum-enhanced data analysis. Finally, we identify future research directions and challenges in the field, emphasizing the need for interdisciplinary collaboration between the data science and quantum computing communities to unlock the full potential of quantum data science.

This study examines the nexus between oil prices and inflation in G20 economies, addressing critical gaps by adopting a comparative approach across three pivotal oil price downturns in 2008, 2014, and 2020 (COVID-19). The study utilized monthly time series data from January 2000 to December 2023 and the Bayesian Structural Time Series (BSTS) approach for causal impact analysis. The study found that during the global financial crisis (December 2007 to June 2014), advanced economies like Australia and the UK displayed varying degrees of negative absolute causal impact, aligning with the deflationary impact of falling oil prices. In contrast, emerging economies faced significant negative causal impacts. From June 2014 to January 2020, diverse inflation impacts were observed across G20 economies after a significant oil price decline. Advanced economies like Australia and emerging economies like Brazil experienced negative impacts, while others showed negligible effects. In the subsequent period from January 2020 to December 2023, amid the COVID-19 pandemic and substantial oil price decline, G20 countries exhibited varied inflation outcomes. Positive absolute effects indicated a notable rise in inflation with China standing out with a substantial negative impact. The wavelet coherence analyses also showed an asymmetrical impact of oil prices on inflation. The findings suggest that policymakers should adopt proactive and adaptive policy frameworks, considering the asymmetric responses of G20 economies to oil price dynamics.

Optical communications are described and analyzed by shaped beams; we challenge the ‎effects of parameters that impact the profile of a Flat Top Gaussian (FTG) beam. When ‎the laser beam propagates throughout the atmosphere, it can be influenced by different ‎optical phenomena including scattering, absorption, and turbulence due to changes in the ‎scintillation index and the forms of intensity that are displayed in the source and receiver ‎planes. In this project, the FTG laser beam that propagates through a weak turbulent ‎region is numerically investigated using open-source software. This simulation will be ‎performed according to a mathematical model based on the split-step beam propagation ‎method. Intensity distributions at the source plane and the received average intensity in ‎atmospheric turbulence are calculated, and additional contour is in the transducer plane. ‎The scintillation index, structure constant, source size, and other parameters, are applied ‎in the Rytov method to quantify the weak turbulent model. Moreover, these parameters ‎are analyzed in near-field propagation. Also, the effects of the beam’s scintillation and ‎beam wander are determined. All results simulated are discussed and compared with the ‎TEM00 Gaussian beam. Finally, these results are compared to measurements in the ‎experimental part of the work.

The reaction between 5-acetylbarbituric acid and 4-dimethylthiosemicarbazide or 4-hexamethyleneiminyl thiosemicarbazide produces 5-acetylbarbituric-4-dimethylthiosemicarbazone (H2AcbDM) and 5-acetylbarbituric-4N-hexamethyleneiminyl thiosemicarbazone (H2Acbhexim). Eight new complexes with different cooper (II) salts have been prepared and characterized using elemental analysis, molar conductance, UV–vis, ESI-HRMS, FT-IR, magnetic moment, EPR and cyclic voltammetry. In addition, three-dimensional molecular structures of [Cu(HAcbDM)(H2O)2](NO3)·H2O (3a), [Cu(HAcbDM)(H2O)2]ClO4 (4), and [Cu(HAcbHexim)Cl] (6) were determined by single crystal X-ray crystallography, and was carried out an analysis of their supramolecular structure. The H-bonded assemblies were further studied energetically using DFT calculations, MEP surface and QTAIM analyses. In these complexes, the thiosemicarbazone coordinates to the metal ion in an ONS-tridentate manner, in the O-enolate/S-thione form. The electrochemical behavior of the thiosemicarbazones and their copper(II) complexes has been investigated at room temperature using the cyclic voltammetry technique in DMFA. The Cu(II)/Cu(I) redox system was found to be consistent with the quasi-reversible diffusion-controlled process.

The unprecedented production and sharing of data, opinions, and comments among people on social media and the Internet in general has highlighted sentiment analysis as a key machine learning approach in scientific and market research. Sentiment analysis can extract sentiments and opinions from user-generated text, providing useful evidence for new product decision-making and effective customer relationship management. However, there are concerns about existing standard sentiment analysis tools regarding the generation of inaccurate sentiment classification results. The objective of this paper is to determine the efficiency of off-the-shelf sentiment analysis APIs in recognizing low-resource languages, such as Greek. Specifically, we examined whether sentiment analysis performed on 300 online ordering customer reviews using the Meaning Cloud web-based tool produced meaningful results with high accuracy. According to the results of the study, we found low agreement between the web-based and the actual raters in the food delivery services related data. However, the low accuracy of the results highlights the need for specialized sentiment analysis tools capable of recognizing only one low-resource language. Finally, there is a significant need for the creation of industry-specific lexical resources that provide decision-makers with valuable insights.

Fever control is essential in patients with severe traumatic brain injury (TBI). The efficacy of therapeutic hypothermia (TH) in severe TBI has been investigated over the last few decades; however, in contrast to experimental studies showing benefits, no evidence of efficacy has been demonstrated in clinical practice. In this review, the mechanisms and history of hypothermia were briefly outlined, while the results of major randomized controlled trials (RCTs) and meta-analyses investigating TH for adult TBI are introduced and discussed. The retrieved meta-analyses showed conflicting results, with a limited number of studies indicating benefits of TH. Some studies have shown benefits of long-term TH compared with short-term TH. Although TH is effective at lowering elevated intracranial pressure (ICP), reduced ICP does not lead to favorable outcomes. Low-quality RCTs overestimated the benefits of TH, while high-quality RCTs showed no difference or worse outcomes with TH. RCTs assessing standardized TH quality demonstrated the benefits of TH. As TBI has heterogeneous and complicated pathologies, applying a uniform treatment may not be ideal. A meta-analysis of young patients who underwent early cooling and hematoma removal showed better TH results. TH should not be abandoned, and its optimal should be advocated on an individual basis.

Existing research indicates that mineralization of Carlin-type gold deposit is related to geological structures, but current studies mostly focus on the qualitative association, and lack quantitative analysis of the relationship between mineralization and structural features, which limits the potential for predictive mineral exploration. In this study, the Nibao Carlin-type gold deposit was selected as the research area to conduct three-dimensional geological modeling, spatial analysis, and three-dimensional prospectivity modeling. Spatial analysis revealed that the majority of gold ore bodies are situated near the main fault, with gold mineralization primarily occurring within a spatial range of approximately -80 meters to 20 meters from the main fault plane. This spatial distribution predominantly aligns in a SW-NE direction. Spatial characteristic extraction of fault slope indicators suggests that the slope angles are conducive to the migration and accumulation of ore-forming hydrothermal fluids, with ore body metal content rapidly increasing within an angle range of approximately 20° to 60°. The shape analysis of the mainfault indicates that the principal spaces of mineralization enrichment are within -10m to 20m of the fault plane undulations, where gold resources are concentrated in a relatively flat area. However, the degree of mineralization is more pronounced in the protruding sections than in the depressed areas. The areas with significant dip changes in faults display higher variations in orebody attitudes, with mineralization noticeably weaker in areas where the fault steepness changes markedly. Ore-bearing units exhibit significantly higher grades within the -17° to 3° interval of fault steepness transition. This interval also sees a rapid accumulation of gold resources. The Nibao gold mine's mineralization is derived from deep, ore-bearing hydrothermal fluids ascending along major fractures, precipitating, and accumulating in favorable ore-hosting spaces (faults, anticline cores) and lithological combinations (sedimentary tuffs, tuffs). Three deep potential gold targets were identified, highlighting the deep western edge of the F1 fault and the deep southeast-trending lower plate as prospective areas for future exploration. This study underscores the effectiveness of 3D prospective modeling as an indispensable tool for elucidating the spatial distribution of fault-controlled Carlin-type gold deposits and their tectonic determinants.

This paper investigates women’s empowerment and their active involvement in governance aimed at promoting sustainable development. The study focuses on examining the roles and processes of co-creation of nature-based solutions (NBS) for water management in Milan. Three research directions were explored: 1) to determine gender-based roles within local governance; 2) to detect semantic groups of NBS based on stakeholders' gender; c) to analyze gender-based linguistic and conceptual patterns of NBS. To achieve our objectives, we converted a sample of audio-video interviews of local stakeholders into textual data along with metadata indicating speakers' roles and gender. Descriptive statistics were applied to explore the governance's roles. We employed a combination of textual analysis and network analysis to identify thematic groups of NBS, and applied a word embedding approach to uncover linguistic patterns indicative of semantic sub-structures. The findings revealed significant demographic diversity. Male stakeholders perceive sustainable development as a process driven by the circular economy and the coordination of territorial authorities, while female stakeholders envision a transformative approach rooted in science, culture, and collaboration. The semantic sub-structure analysis highlighted a tendency among male governance to emphasize specialized skills, whereas female governance placed greater emphasis on problem definition rather than resolution.

Hybrid Renewable Energy Systems (HRES) integrate renewable sources, storage, and optionally conventional energies, offering an eco-friendly solution to fossil fuels. Microgrids (MGs) bolster HRES integration, enhancing energy management, resilience, and reliability at various levels. This study, emphasizing the need for refined optimization methods, investigates three themes: renewable energy, microgrid, and multiobjective optimization (MOO), through a bibliometric analysis of 470 Scopus documents from 2010-2023, analyzed with SciMAT software. It segments the research into two periods, 2010-2019 and 2020-2023, revealing a surge in MOO focus, especially in the latter period, with a 35% increase in MOO-related research. This indicates a shift towards com-prehensive energy ecosystem management that balances environmental, technical, and economic elements. The initial focus on MOO, genetic algorithms, and energy management systems has expanded to include smart grids and electric power systems, with MOO remaining a primary theme in the second period. The increased application of Artificial Intelligence (AI) in optimizing HMGS within the MOO framework signals a move towards more sustainable, intelligent energy solutions. Despite progress, challenges remain, including high battery costs, the need for reliable MOO data, the intermittency of renewable energy sources, and HMGS network scalability issues, highlighting directions for future research.

Permafrost covers about 23% ~ 25% of the land in the northern hemisphere, mainly in Russia, Canada, Alaska, Northeast and Qinghai Tibet Plateau (QTP) in China. Many engineering especially the transportation has been in the permafrost regions above. Under the action of highways construction and global warming, permafrost under infrastructures is degraded and causes serious damage. Two phases closed thermosyphon (TPCT) is a widely accepted green countermeasure against the problem in permafrost regions. Although it has been applied to prevent permafrost degradation, their application presents significant challenges on account of the stronger endothermic action of asphalt pavement. This paper focused on the thermosyphon technology and application in the permafrost. Moreover, the article highlighted the excellent working performance of the TPCT that improving the stability of the infrastructures and prevent it degrading due its excellent efficiency of heat transfer. The industrial applications of the TPCT were also summarized, along with their limitations. Finally, the results reported in this paper can provide a valuable guidance for the design of the TPCT and construction of the permafrost regions in the future.

With the inclusion of Internet Gaming Disorder (IGD) in both the DSM-5 and ICD-11, understanding the prevalence and diagnostic discrepancies is crucial for developing appropriate interventions. This study presents a meta-analysis of the prevalence of IGD based on two diagnostic criteria. We systematically searched PubMed, Web of Science databases. 17 studies were included in the final analysis, The analysis incorporated studies employing the DSM-5 and ICD-11 criteria and focused on the impact of various factors, including study location, sample size, and quality score, on the reported prevalence rates using a random-effects model. Heterogeneity and publication bias were analyzed using an I2 test and Galbraith plots , The prevalence of IGD varied among the selected studies, with a general pooled prevalence of 5% (95% CI: 3%–7%). Subgroup analysis indicated that the prevalence rates of IGD (DSM-5 criteria) and GD (ICD-11 criteria) do not show significant differences. DSM-5-based scales yielded varied results, while heterogeneity among the studies was high (I2 = 98.50). In contrast, ICD-11-based scales produced more consistent and less variable findings. Our findings highlight that assessment scales, not diagnostic criteria, impact IGD prevalence. This underscores the importance of adopting standardized methodologies to guide public health interventions. However, given the limited research based on ICD-11 diagnostic criteria, further investigation is necessary to determine the variations in prevalence rates of IGD under different diagnostic standards.

Bacteria belonging to the genus Micromonospora are recognized as microorganisms with potential to be used in biotechnology processes, including their beneficial influence on plant growth and biocontrol of phytopathogens. In this study, nineteen Micromonospora isolates originating from root nodules of white clover plants were taxonomically assigned based on the phylogenetic analysis of the 16S rRNA gene and four housekeeping genes. The antifungal properties of the bacteria against phytopathogenic Botrytis cinerea, Fusarium oxysporum, Fusarium equiseti, Sclerotinia sclerotiorum, and Verticillium albo-atrum were tested with the agar plug test and the dual culture test. The ability to produce various metallophores was determined with the agar plug diffusion test on modified CAS agar medium. ISP2 broth amended with 0.2% L-tryptophan was used to indicate the bacterial ability to produce auxins. Strains belonging to M. tulbaghiae, M. inaquosa, and M. violae showed in vitro potential as antimicrobial agents against the tested fungi. M. inaquosa strain 152, M. violae strain 126, M. violae strain 66 and M. violae strain 45 were recognized as the most efficiency metallophores producers. M. alfalfae strain 55 and M. lupini strain 5052 were identified as the most promising auxin compound producers and, therefore, as potential plant growth promoting bacteria.

Observing customers is one of the methods to uncover their needs. By closely observing how customers use products, we can indirectly experience their interactions and gain a deep understanding of their feelings and preferences. Through this process, companies can design new products that have the potential to succeed in the market. However, traditional methods of customer observation are time-consuming and labor-intensive. In this study, we propose a method that leverages the analysis of online customer reviews as a substitute for direct customer observations. By correlating Customer Journey Map (CJM) with online reviews, this research establishes a verb-centric analysis that produces a CJM based on online review data. Various Text analysis techniques were utilized in this process. Through empirical data analysis, we validated that indirect observation based on customer reviews can be performed more efficiently than traditional methods. Additionally, we observed that the customer behavior VOC (Voice of Customer) identified during the CJM mapping process offers unique insights that are distinct from traditional product feature-centric review analyses. To verify the usefulness of these behavior VOC, we evaluated the quantitative analysis results of the same reviews through product development experts. Experts recognized these customer behavior VOC as useful information for developing new products.

Sentiment analysis plays a crucial role in understanding customer feedback, guiding product development, and informing business decisions. This paper introduces term sentiment entropy (TSE), a novel weighting method that leverages the distribution of sentiment labels associated with words to enhance text classification accuracy. TSE complements traditional TF-IDF techniques by capturing the nuances of sentiment variation across different contexts. Experiments across diverse public datasets demonstrate TSE's potential to improve sentiment analysis performance, especially in capturing subtle sentiment shifts and adapting to specific domains. While computational cost and label quality pose challenges, TSE offers a promising avenue for refining sentiment analysis and opening new research frontiers.

Malocclusions have a continuously increasing prevalence from a generation to another as a result of climate changes, soil, atmosphere and water pollution. All of these aspects have unfavorable consequences on the nutritional scheme. Thus, nutrition together with other etiopathogenic factors contribute to complex alterations in the somatic development of the entire organism and, implicitly, of the cephalic extremity. The study group included 4147 children from randomly selected schools from Vâlcea County, Romania. The aim of this study is to determine the prevalence of malocclusions in schoolchildren from Vâlcea County, Romania, according to the three main classes of malocclusions (according to Angle’s classification), age groups (from 6 to 10 years old and from 11 to 14 years old), gender (male and female) and place of origin (rural and urban). For Angle class I malocclusions we recorded the highest prevalence (48,78% from the total number of schoolchildren with malocclusions), followed by Angle class II malocclusions (45,85% from the total number of schoolchildren with malocclusions) and for Angle class III malocclusions we found the lowest prevalence (5,37% from the total number of schoolchildren with malocclusions).According to gender, we found the highest prevalence in female gender (29,90% from the total number of female subjects), while in male gender we recorded a prevalence of 27,70% from the total number of male subjects. Regarding the place of origin, there is a higher prevalence of malocclusions in the urban areas (29,16%). The study subgroup included 140 children randomly selected from the total number of subjects from the study group. They were included in a more advanced study. The aim is to find potential associations between the presence of malocclusions and various oral variables. Categorical variables were expressed as numerical values and percentages, and their association was evaluated with either the Chi-square test of association or homogeneity, or the Fisher Exact test. The acquired data were incorporated into a binomial logistic regression model to assess the likelihood of developing malocclusions in relation to the following variables: defective phonation, bruxism, frequency of teeth brushing, onychophagia, oral respiration, infantile deglutition, placing objects between the maxillaries, thumb sucking and salivary aspects. It is also aimed to compare the results obtained with similar ones from the specialized literature.

Background: The monocyte-phagocyte system (MPS), including monocytes/macrophages and dendritic cells (DCs), plays a key role in anti-viral immunity. We aimed to analyze the prognostic value of the MPS components on in-hospital mortality in a cohort of 58 patients (M/F ; mean ageSD years) with COVID-19 pneumonia and 22 age- and sex-matched healthy controls. Methods: We measured frequencies and absolute numbers of peripheral blood CD169+ monocytes, conventional CD1c+ and CD141+ (namely cDC2 and cDC1), and plasmacytoid CD303+ DCs by means of multi-parametric flow cytometry. A gene profile analysis of 770 immune-inflammatory related human genes and 20 SARS-CoV-2 genes was also performed. Results: Median frequencies and absolute counts of CD169-expressing monocytes were significantly higher in COVID-19 patients than in controls (p 0.04 and p 0.01, respectively). Conversely, percentages and absolute numbers of all DC subsets were markedly depleted in patients (p

During the thinning process, in the semiconductor industry, residual stress from thin films can cause severe warpage in wafers, which can compromise their processability and packaging. This warpage can lead to bifurcation or buckling, making it important to understand this phenomenon for the manufacturing of large semiconductor wafers. We conducted a finite element analysis of the thinning process using ANSYS mechanical enterprise 2023/R2 to investigate the asymmetric curvatures resulting from bifurcation in a standard 300 mm Si (001) wafer. We induced an asymmetry in the system by applying a slight force on a point of the circumferential region perpendicularly to the substrate. We also simulated the compressive stress from the damaged layer formed during the thinning process and considered its influence on warpage and bifurcation in both linear and non-linear cases. We also included the influence of Earth's gravity induced deflection (GID) and investigated the influence of the compressive stress damaged layer on the grinding process of the whole wafer by adding a metal front layer to the ground back damaged wafer.

This study employs Principal Component Analysis to examine cranial measurements obtained from both extant and fossil specimens spanning 38 species and comprising over 300 individuals within the subfamily Cervinae. Our findings elucidate craniometric distinctions among cervids characterized by varying body sizes and certain evolutionary adaptations. While our results generally corroborate previous assertions regarding the limited craniometric variability among plesiometacarpal deer, they also unveil specific cranial adaptations within certain genera and species. The Principal Component Analysis of craniometric data revealed that giant and large-sized deer display significantly broader ecomorphological diversity in cranial shape compared to small-sized deer. Secondly, small-sized deer exhibit greater uniformity in their cranial shape, appearing densely clustered on the factorial map. Thus, we conclude that body size imposes ecological constraints, limiting the available niches due to eco-physiological factors. The study demonstrates that endemic insular deer do not evolve consistent craniometric features attributable to insular isolation, while the cranial proportions of medium-to-small sized deer delineate a ubiquitous morphological archetype characteristic of numerous cervid taxa spanning diverse phylogenetic lineages and sharing comparable body sizes. This group of "Dama-like" deer, characterized by similar body size, metabolic rates, ecological needs, and cranial morphometry, is referred to here as the fundamental eco-physiological type, typical of warm regions within the Palearctic and Oriental biogeographic realms..

An electrothermal analysis for barium titanate based ceramics is presented combining the Heywang–Jonker model for the electric resistivity with a heat dissipation mechanism based on natural convection and radiation in a one dimensional model on the device level with voltage as the control parameter. Both PTC and NTC effects are accounted for through the double Schottky barriers at the grain boundaries of the material. The problem formulated in this way admits uniform and non–uniform multiple steady state solutions that do not depend on the external circuit. The numerical bifurcation analysis reveals that the PTC effect gives rise to several multiplicites above the Curie point, whereas the NTC effect is responsible for the thermal runaway (temperature blowup). The thermal runaway phenomenon as a potential thermal shock could be among the possible reasons for the observed thermomechanical failures (delamination fracture). The theoretical results for the NTC regime and the thermal runaway are in agreement with experimental flash sintering results obtained for 3% and 8% yttria stabilized zirconia.

Partial Information Decompositions (PIDs) aim to categorize how a set of source variables provide information about a target variable redundantly, uniquely, or synergetically. The original proposal for such an analysis used a lattice-based approach and gained significant attention. However, finding a suitable underlying decomposition measure is still an open research question, even at an arbitrary number of discrete random variables. This work proposes a solution to this case with a non-negative PID that satisfies an inclusion-exclusion relation for any f-information measure. The decomposition is constructed from a pointwise perspective of the target variable to take advantage of the equivalence between the Blackwell and zonogon order in this setting. The zonogons correspond to the Neyman-Pearson region for an indicator variable of one target state and f-information is the expected value of quantifying its boundary. We prove that the decomposition satisfies the axioms of the original decomposition framework and guarantees non-negative partial information results. We highlight that our decomposition behaves differently depending on the used information measure, which can be utilized for different applications. We additionally show how our proposal can be used to obtain a non-negative decomposition of Rényi-information at a transformed inclusion-exclusion relation, and for tracing partial information flows through Markov chains.

Diabetic retinopathy (DR) is the primary factor leading to vision impairment and blindness in diabetic people. Uncontrolled diabetes can damage the retinal blood vessels. Initial detection and prompt medical intervention are vital in preventing progressive vision impairment. Today's growing medical field poses more significant workload and diagnostic demands on medical professionals. In the proposed study, a convolutional neural network (CNN) is employed to detect the stages of DR. This research is crucial for studying DR because of its innovative methodology incorporating two different public datasets. This strategy enhances the model's capacity to generalize unseen DR images, as each dataset encompasses unique demographics and clinical circumstances. The network can learn and capture complicated hierarchical image features with asymmetric weights. Each image undergoes preprocessing using contrast-limited adaptive histogram equalization (CLAHE) and the discrete wavelet transform (DWT). The model is trained and validated using the combined datasets of Dataset for Diabetic Retinopathy (DDR) and the Asia Pacific Tele-Ophthalmology Society (APTOS). The CNN model is tuned with different learning rates and optimizers. The CNN model with Adam optimizer achieved 70% accuracy and an area under curve (AUC) score of 0.82. The recommended study results may reduce diabetes-related vision impairment by early DR severity identification.

Antimony (Sb) has gained significance as a critical raw material (CRM) within the European Union (EU) due to its strategic importance in various industrial sectors, particularly in the textile industry for flame retardants and as a component of Sb-based semiconductor materials. Moreover, Sb is emerging as a potential alternative for anodes used in lithium-ion batteries, a key element in the Energy transition. This study focused on exploring the feasibility of identifying and quantifying Sb mineralizations through the spectral signature of soils using reflectance spectroscopy, a non-invasive remote sensing technique, and by employing deep learning algorithms such as Convolutional Neural Networks (CNNs). Common signal preprocessing techniques were applied to the spectral data, and the soils were analyzed by Inductively Coupled Plasma Mass Spectrometry (ICP-MS). Despite achieving high R-squared values, the study faces a significant challenge of generalization of the model to new data. Despite the limitations, this study provides valuable insights into potential strategies for future research in this field.

Magnetic levitation vibration isolation platform are essential for testing space telescopes. This paper presents the design of a Large Air-Gap Voice Coil Motor (LAG-VCM) specifically for use in such platforms. The electromagnetic design of the voice coil motor begins with the Equivalent Magnetic Circuit Method, followed by the analysis and optimization of the motor design using Finite Element Analysis (FEA). Subsequently, a prototype was constructed and tested. The test results confirm that the prototype meets the design specifications and requirements.

Over the last decades, an important number of regional and global Digital Elevation Models (DEMs) have been released publicly. As a consequence, researchers need to choose between several of these models to perform their studies and to use these DEMs as third-party data to compute derived products (e.g., for orthorectification). However, the comparison of DEMs is not trivial. For most quantitative comparisons, DEMs require to be expressed in the same Coordinate Reference System (CRS), sampled over the same grid (i.e., be at the same ground sampling distance with the same pixel-is-area or pixel-is-point convention), and with heights relative to the same Vertical Reference System (VRS). Thankfully, many open tools allow us to perform these transformations precisely and easily. Despite these rigorous transformations, local or global planimetric displacements may still be observed from one DEM to another. These displacements, or disparities, may lead to significant biases in comparisons of DEM elevations or derived products such as slope, aspect or curvature. Therefore, the control of DEM planimetric accuracy is certainly the most important task to perform at first before any comparison. This paper presents the disparity analysis method enhanced to achieve a sub-pixel accuracy, by interpolating the linear regression coefficients computed within an exploration window. This new method is significantly faster than oversampling the input data because it uses the correlation coefficients that have been already computed in the disparity analysis. To demonstrate the robustness of this algorithm, artificial displacements have been performed in a 11x11 grid with a 0.1-pixel step in both directions. The Copernicus DEM GLO-30 has been interpolated by a “classical” bicubic to achieve these 11x11 displacements. This validation method has been applied in four 10 km x 10 km DEMIX tiles showing different height distributions. Globally, this new sub-pixel accuracy method is robust. Artificial displacements have been retrieved with with typical errors (e_b) ranging from 12 to 20 % of the pixel size (worst case in Croatia).These errors in displacement retrievals are not constant in the 11x11 grid and the overall error E_b depends on the roughness (altimetry variations) encountered in the different tiles. The second idea of this paper is to assess the impact of the bicubic parameter (slope of the weight function at a distance d=1 of the interpolated point) on the accuracy of the displacement retrieval. By considering E_b as a quality indicator, tests have been performed in the four DEMIX tiles making the bicubic parameter vary between -1.5 and 0.0 by step of 0.1. For each DEMIX tile, the best bicubic (BBC) parameter b* is interpolated from the four E_b minimal values. This BBC parameter b* is low for flat areas (around -0.95) and higher in mountainous areas (around -0.75). The roughness indicator is the standard deviation of the slope norms computed from all the pixels of a tile. A logarithmic regression analysis performed between the roughness indicator and the BBC parameter b* computed in 67 DEMIX tiles shows a high correlation (r=0.717). The logarithmic regression formula estimating the BBC parameter from the roughness indicator is generic and may be applied to estimate the displacements between two different DEMs. This formula may also be used to set up a future Adaptative Best BiCubic (ABBC) that will estimate the local roughness in a sliding window to compute a local BBC.

During public health events, Active Mobility (walking and cycling) plays an important role in securing residents' travel. To enhance the resilience of urban transportation, this article integrates the travel environment elements for walking and cycling and constructs a travel environment for Active Mobility evaluation index system. This article uses survey data from the main urban area of Harbin in the context of the COVID-19 pandemic in May 2022, and combines the Gradient Boosting Decision Tree (GBDT) and Impact-Asymmetry Analysis (IAA) methods to analyze the satisfaction of the travel environment for Active Mobility. It proposes strategies for optimizing the travel environment for Active Mobility, ensuring residents' travel during public health events, guiding them to adopt Active Mobility, and improving urban transportation resilience. This research shows that Active Mobility can enhance urban transportation resilience. In addition, there are differences in resident demand for walking and cycling environments in the travel environment for Active Mobility. Residents are more concerned about the comfort of the walking environment, while they prioritize the convenience of the cycling environment.

Intense climate change and rapid urbanization have increased the risk of urban flooding, seriously affecting urban economic and social stability. Enhancing the urban flood resilience (UFR) has required a new solution to cope with urban flood disasters. In this study, taking Yingtan city as an example, a system of indicators for evaluating UFR was constructed, with 17 representative indicators, comprising three subsystems: socio-economic, ecological and infrastructural. A hybrid (FAHP-EWM)-TOPSIS model was applied, to develop an index-based measurement to compare and evaluate UFR, and Gray Relational Analysis (GRA) was used to discover the main factors affecting UFR. In addition, the natural discontinuous method was innovatively used to divide the UFR grade interval into levels, and the grade change was evaluated based on the TOPSIS method. The results showed that (1) from 2010 to 2022, the UFR in Yingtan City increased by 80.69%, and the factors affecting UFR are highly correlated with urban infrastructure development. However, the ecological resilience in the subsystem showed a fluctuating downward trend, because of the influence of the surface area of lakes and rivers. (2) The grades of UFR for Yingtan City increased from Level III (2010 and 2016) to Level IV (2022), with local financial expenditures and the age structure of the population being the main factors currently limiting the development of UFR. The study provides a theoretical basis for the construction of an indicator system for assessing the UFR of Yingtan and proposes practical improvement directions for UFR.

Recently, a high internal surface of the titanium alloy pipe is required due to the increment of various applications of the pipe such as aerospace. However, the traditional machining process is unable to effectively polish the internal surface of the slender pipe. Thus, a vertical magnetorheological polishing (VMRP) apparatus is carried out in this work to implement high polishing performance on the internal surface of the titanium alloy pipe. The polishing process is realized by the combination of the rotating motion of the pipe and the reciprocating linear motion of the polishing head. Moreover, a series of comparative experiments are conducted to investigate the polishing mechanism of magnetorheological (MR) fluid and enhance the polishing performance. It is shown from the experimental results that proposed VMRP approach exhibits the better polishing performance than the conventional horizontal MR polishing method under same testing conditions. This is because the proposed VMRP method well eliminates the traces of polishing particles owing to the combination of polishing particles with different sizes. In addition, it is identified from the experimental test that the polishing time of the VMRP required to achieve the same polishing effect as the conventional method is shortened under the combination of different rotation speeds. It is identified from the above benefits of the VMRP that the final surface roughness after polishing is below 0.05 μm.

Abstract Background Context Pelvic ring fractures are becoming more common in the aging population and can prove to be fatal, having mortality rates between 10% and 16%. Stabilization of these fractures is challenging and often require immediate internal fixation. Therefore, it is necessary to have a biomechanical understanding of the different fixation techniques for pelvic ring fractures. Methods A previously validated three-dimensional finite element model of the lumbar spine, pelvis, and femur was used for this study. A unilateral pelvic ring fracture was simulated by resecting the left side of the sacrum and pelvis. Five different fixation techniques were used to stabilize the fracture. A compressive follower load and pure moment was applied to compare different biomechanical parameters including range of motion (contralateral sacroiliac joint, L1-S1 segment, L5-S1 segment), and stresses (L5-S1 nucleus stresses, instrument stresses) between different fixation techniques. Results Transiliac -trans sacral screw fixation at S1 and S2 showed the highest stabilization for horizontal and vertical displacement at the sacral fracture site and reduction of contralateral sacroiliac joint for bending and flexion range of motion by 165% and 121%, respectively. DTSF (Double transiliac rod and screw fixation) model showed highest stabilization in horizontal displacement at the pubic rami fracture site, while the L5_PF_W_CC (L5-Ilium posterior screw fixation with cross connectors) and L5_PF_WO_CC ( L5-Ilium posterior screw fixation without cross connectors) showed higher rod stresses, reduced L1-S1 (approximately 28%), and L5-S1 (approximately 90%) range of motion. Conclusions Longer sacral screw fixations were superior in stabilizing sacral and contralateral sacroiliac joint range of motion. Lumbopelvic fixations displayed a higher degree of stabilization in the horizontal displacement compared to vertical displacement of pubic rami fracture, while also indicating the highest rod stresses. When determining the surgical approach for pelvic ring fractures, patient-specific factors should be accounted for to weigh the advantages and disadvantages for each technique.

The high prevalence of thyroid nodules and increased availability of neck ultrasound have led to an increased incidence of diagnostic thyroid fine needle aspirations, with approximately 20% yielding indeterminate results. The recent availability of molecular tests has helped guide the clinical management of these cases. This paper aims to review and compare three main commercially available molecular cytology platforms in the U.S. – Afirma GSC, Thyroseq GC, and ThyGeNEXT+ThyraMIR. Sequential improvements of the Afirma GSC and Thyroseq GC tests have led to higher positive and negative predictive values, sensitivity, and specificity. Comparative studies revealed similar diagnostic performance between these tests, with considerations for factors such as cost and processing time. Thyroseq GC provides detailed genomic information and specific management recommendations. ThyGeNEXT+ThyraMIR, though less studied, presents promising results, particularly in miRNA analysis for weak driver mutations. Challenges in interpreting results include variations in reporting and the evolving nature of testing platforms. Questions persist regarding cost-effectiveness and the utility of ultrasound characteristics in selecting candidates for molecular testing. While molecular testing has primarily served diagnostic purposes, advancements in understanding genetic alterations now offer therapeutic implications. FDA-approved options target specific genetic alterations, signaling a promising future for tailored treatments.

The fifth Industrial revolution (I5.0) prioritizes resilience and sustainability, integrating cognitive cyber-physical systems and advanced technologies to enhance machining processes. Numerous research studies have been conducted to optimize machining operations by identifying and reducing the sources of uncertainty and estimating the optimal cutting parameters. Virtual modeling and Tool Condition Monitoring (TCM) methodologies have been developed to assess the cutting states during machining processes. With a precise estimation of cutting states, the safety margin necessary to deal with the uncertainties can be reduced, resulting in improved process productivity. This paper reviews the recent advances in high-performance machining systems with a focus on the cyber-physical models developed for the cutting operation of difficult-to-cut materials using cemented carbide tools. An overview of the literature and background on the advances in the offline and online process optimization approaches have been presented. Process optimization objectives such as tool life utilization, dynamic stability, enhanced productivity, improved machined part quality, and reduced energy consumption and carbon emissions are independently investigated for the offline and online optimization methods. Addressing the critical objectives and constraints prevalent in industrial applications, the paper explores the challenges and opportunities inherent in developing a robust cyber-physical optimization system

The integration of Artificial Intelligence (AI) with the Internet of Things (IoT) has propelled technological innovation across various industries. This systematic literature review explores the current state and future trajectories of AI in IoT, with a particular focus on emerging trends in intelligent data analysis and privacy protection. The proliferation of IoT devices, marked by voluminous data generation, has reshaped data processing methods, providing actionable insights for informed decision-making. While previous reviews have offered valuable insights, they often fall short of comprehensively addressing the multifaceted dimensions within the AI-driven IoT landscape. This review aims to bridge this gap by systematically examining existing literature and acknowledging the limitations of past studies. To achieve this aim, the study uses a meticulous approach guided by established methodologies. The chosen methodology ensures the rigor and validity of the review, aligning with PRISMA guidelines for systematic reviews. This systematic literature review serves as a comprehensive guide for researchers, practitioners, and policymakers, offering insights into the current landscape and paving the way for future research directions. The identified trends and challenges provide a valuable resource for navigating the evolving domain of AI in IoT, fostering a balanced, secure, and sustainable advancement in this dynamic field.

The metrological performance of FBG strain sensing systems is a critical premise for the precision of plastics water support pipeline structural deformation measurement, but the strain transfer loss of FBG attached on the plastics pipe subjected by dynamic force is unclear. This paper presents the first study on the effects of strain transfer between FBG, and acrylate polymer blended with poly resin (ABR)pipe sheets loaded by static and dynamic force. Theoretical methods of dynamic strain transfer theory combine with the exponentially decaying sinusoidal shock force time course is deduced and various dynamic parameters sensitivities studies are carried out, as well as that of the geometric parameters. The result of the dynamic theory is compared with the calibration test outcomes, while the ASTR of FBG attached on ABR sheet is compared with distributed optical fiber sensors (DOFS) and other pipe materials such as PVC, concrete, and steel. Results show that the ASTR of FBG is more accurate than that of the DOFS, and the grows of ASTR depending on the paste length of FBG, the Young's modulus of the middle materials, the thickness of the middle materials and attenuation coefficient. Paste length produced the largest increase, yet the magnitude and loading speed of the external force has unexpectedly little effect on ASTR. FBG seem low error, insensitive with dynamic force and independent with the material of matrix, and this demonstrates benefits that are stronger across the board than DOFS. This is not currently recognized by standards or by most reported studies.

Since the outbreak of the COVID-19 pandemic, patients infected with COVID-19 may experience abnormal heart rates, posing potential health risks. This study proposes a non-contact method for measuring heart rate (HR) and heart rate variability (HRV) to effectively reduce the risk of infection and assist healthcare professionals in more accurate diagnosis and treatment. In this study, except for the different image acquisition method, other research processes and methods are similar to the research methods in [15]. The image acquisition method is changed from forehead image to palm image. The new non-contact measurement performance of the proposed method can effectively not only avoid infection concerns but also obtain heart rate and HRV quickly and conveniently, providing higher accuracy for physiological parameters, root mean square error (RMSE), and mean absolute percentage error (MAPE) compared to those in recently published papers.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Code summarization plays a vital role in aiding developers with program comprehension by generating corresponding textual descriptions for code snippets. While recent approaches have concentrated on encoding the textual and structural characteristics of source code, they often neglect the global hierarchical features causing limited code representation. Addressing this gap, our paper introduces the Statement-grained Hierarchy enhanced Transformer model (SHT), a novel framework that integrates global hierarchy, syntax, and token sequences to automatically generate summaries for code snippets. SHT is distinctively designed with two encoders to learn both hierarchical and sequential features of code. One relational attention encoder processes the statement-grained hierarchical graph, producing hierarchical embeddings. Subsequently, another sequence encoder integrates these hierarchical structures with token sequences. The resulting enriched representation is then fed into a vanilla Transformer decoder, which effectively generates concise and informative summarizations. Our extensive experiments demonstrate that SHT significantly outperforms state-of-the-art approaches on two widely used Java benchmarks. This underscores the effectiveness of incorporating global hierarchical information in enhancing the quality of code summarizations.

In recent years, e-commerce platforms have replaced conventional marketplaces. People are rapidly adopting internet shopping due to the convenience of making purchases from the comfort of their homes. Online review sites allow customers to share their thoughts on products and services. Customers and businesses are increasingly relying on online reviews to assess and improve the quality of products. Existing literature uses Natural language processing (NLP) to analyze customer reviews for different applications. Due to the growing importance of NLP for online customer reviews, this study attempts to provide a taxonomy of NLP applications based on existing literature. This study also examined emerging methods, data sources, and research challenges by reviewing 154 publications from 2013 to 2023 that explore state-of-the-art approaches for diverse applications. Based on existing research, the taxonomy of applications divides literature into five categories: sentiment analysis, review analysis, customer feedback and satisfaction, user profiling, and marketing and reputation management. It is interesting to note that the majority of existing research relies on Amazon user reviews. Additionally, recent research has encouraged the use of advanced techniques like Bidirectional Encoder Representations from Transformers (BERT), Long Short-Term Memory (LSTM), and ensemble classifiers. The rising number of articles published each year indicates increasing interest of researchers and continued growth. This survey additionally addresses open issues, providing future directions in online customer review analysis.

Eggplant or brinjal is one of the most consumed and important nutrient-dense tropical solanaceous vegetable crops grown worldwide. Little leaf is a disease especially widespread in brinjal in India where it is associated with the presence of phytoplasmas. To clarify the epidemiology of this disease and verify its seed transmission potential, seedlings and their progeny derived from symptomatic mother plants field-collected in Dharwad district of Karnataka State, India, were sowed under insect proof conditions in greenhouse. The resulting first- and second-generation seedlings obtained were tested at different times after germination by DNA extraction and amplification of 16S rRNA gene of phytoplasmas. Tissues from field collected symptomatic brinjal plants were also tested following the same procedure. The amplicons obtained were subjected to restriction fragment length polymorphism (RFLP) analysis and sequencing for phytoplasma identification. The detected phytoplasmas belonged to 16SrI, 16SrII, 16SrIII, 16SrV, 16SrVI, and 16SrXII groups. Several fruits produced from the first-generation seedlings showed germination of the seeds inside the fruit and resulted to be phytoplasma positive. This demonstrates the seed transmission of phytoplasmas in eggplants for two subsequent generations. This finding highlights the risk of additional source of infection represented by asymptomatic and infected seedlings under field conditions and contribute to explain the epidemic spread of phytoplasmas in brinjal cultivations in India and in the other eggplant growing areas of the world.

Urban gardens have important social, environmental and economic roles in big cities, contributing to their sustainability. However, food production in urban gardens may be compromised due to soil pollution that resulted from decades of industrial non-regulated environmental activity and mobile transport. In this study, 12 soils from the urban agricultural area of Rome (Italy) were analyzed for the metals Be, Ba, Pb, Co, Ni, V, Zn, Hg, Cd, As, Cu, and Cr. All but one of the soils under analysis were characterized by at least one metal concentration above the threshold limit defined by the Italian Legislative Decree 152/2006 (ILD) for agricultural soils. Multivariate analysis showed that the soils could be classified into five clusters: clusters I and II had relatively lower mean metal concentrations; clusters III, IV, and V had relatively higher mean metal concentrations with several metal concentrations above the threshold proposed by ILD. Three factors contributing to the variability of the metal’s concentration in the soils under investigation were identified: geological factor, related with metals As, Ba, Be, and V; anthropogenic factor, related with Pb and Cu; and, a mixed factor related with Co, Cr, Ni, and Zn. High metal content may limit the utilization of urban soils as urban gardens for food production.

The 21st century has seen the launch of new space-borne sensors based on LiDAR (light detection and ranging) technology developed in the second half of the 20th century. LiDAR was initially developed to integrate laser-focused imaging with the capability to determine distances through the measurement of signal return times, utilizing suitable sensors and data acquisition electronics. Nowadays, these sensors have transformed into robust instruments, offering novel opportunities for mapping terrain, canopy heights, and estimating above-ground biomass (AGB) across local to regional scales. This work aims to analyze the scientific impact of these sensors on large-scale for-est mapping to retrieve 3D canopy information, monitor forest degradation, estimate AGB, and model key ecosystem variables such as primary productivity and biodiversity. In this way, a worldwide bibliometric analysis of this topic was carried out based on up to 412 publications in-dexed in the Scopus database during the period 2004-2022. The results showed that the number of published documents increased exponentially in the last five years, coinciding with the commis-sioning of two new LiDAR space missions: Ice, Cloud and Land Elevation Satellite (ICESat-2) and Global Ecosystem Dynamics Investigation (GEDI). These missions are providing data since 2018 and 2019, respectively. The journal that demonstrated the highest productivity in this field was "Remote Sensing," and among the leading contributors, the top five countries in terms of publica-tions were the USA, China, the UK, France, and Germany. In the realm of prominent research in-stitutions, France boasted six, the USA had four, China had three, while the UK and Canada each had one. The upward trajectory in the number of publications recorded from 2004 to 2022 catego-rizes the subject under investigation as a highly trending research topic, particularly within the context of enhancing the administration of forest resources and engaging in global climate treaty frameworks mandating the surveillance and reporting of carbon stocks in forests. The recent launch in August 2022 of the Terrestrial Ecosystem Carbon Monitoring Satellite (TECMS; China State Administration of Forestry and Grassland), along with the planned launch in the coming years of up to three new space sensors, such as the Multi-footprint Observation LiDAR and Im-ager (Japan Aerospace Exploration Agency), the BIOMASS P-band Synthetic Aperture Radar (SAR) (European Space Agency), and the LiDAR Surface Topography (LIST; NASA), will greatly contribute to expanding the ability to map and monitor forest systems at very large scales. In this context, the integration of space-borne data, including imagery, SAR, and LiDAR, is anticipated to steer the trajectory of this research in the upcoming years.

Microvascular self-healing composite materials have significant potential for application and their mechanical properties need in-depth investigation. In this paper, tensile and compressive properties of woven fabric carbon fiber reinforced polymers (CFRP) laminates containing three-dimensional microvascular channels were investigated experimentally. Several detailed finite element (FE) models were established to simulate the mechanical behavior of the laminate and the effectiveness of different models were examined. The damage propagation process of the microvascular laminates and the influence of microvascular parameters were studied by the validated models. The results show that microvascular channels arranged along the thickness direction (z-direction) of the laminates are critical locations under the loads. The channels have minimal effect on the stiffness of the laminates but causing a certain reduction in strength, which varies approximately linearly with the z-direction channel diameter within its common design range of 0.1~1mm. It is necessary to consider the resin-rich region formed around microvascular channels in the warp and weft fiber yarns of the woven fabric composite when establishing the FE model. And the layers in model should be assigned with equivalent unidirectional ply material in order to calculate the mechanical properties of laminates correctly.

Apple latent spherical virus (ALSV) is widely used as a virus-induced gene silencing (VIGS) vector for function genome study. However, the application of ALSV in soybean is limited by the resistance of many varieties. In this study, the genetic loci linked to the resistance of a resistant soybean variety Heinong 84 was mapped by high-throughput sequencing‒Bulk Segregation Analysis (HTS‒BSA) using a hybrid population crossed from Heinong 84 and a susceptible variety Zhonghuang 13. Results showed that the resistance of Heinong 84 to ALSV is controlled by two genetic loci located on chromosome 2 and 11, respectively. Cleaved amplified polymorphic sequences (CAPS) markers were developed for identification and genotyping. Inheritance and biochemical analyses suggest that the resistance locus on chromosome 2 plays a dominant dose-dependent role, while the other locus contributes a secondary role in resisting ALSV. The resistance locus on chromosome 2 might encode a protein that can directly inhibit viral proliferation, while the secondary resistance locus on chromosome 11 may encode a host factor required for viral proliferation. Together, these data reveal novel insights on the resistance mechanism of Heinong 84 to ALSV, which will benefit for the application of ALSV as a VIGS vector.

This study investigates the elastic buckling behaviour of skew Functionally Graded Material (FGM) thin plates featuring a circular opening. FGM materials, known for their unique property gradients, have gained prominence in structural engineering due to their mechanical performance and durability. Including a circular opening introduces a critical geometric consideration, influencing the structural stability and load-carrying capacity of FGM plates. The study examines the effects of the skew angle, plate’s aspect ratio, opening position, and size on the critical buckling load, normalized buckling load, and various buckling failure modes through computer modelling and finite element analysis. The results offer valuable insights into the interplay between material heterogeneity, geometric configuration, and structural stability. For instance, the critical buckling load increases by 29%, 82%, and 194% with the increment of skew angle from 0° to 30°, 45°, and 60°, respectively. Moreover, as the opening shifts from the plate’s edge closer to the center, the critical buckling load decreases by 26%. This research contributes to the advancement of understanding FGM thin plates’ behaviour under skew loading conditions, with implications for the design and optimization of innovative structures. The findings presented provide a foundation for further exploration of advanced composite materials and their applications in structural engineering.

AliAmbra is a project developed to explore and promote high-quality catches of the Amvrakikos Gulf GP to Artas’ wider regions. In addition, this project aimed to implement an integrated plan of action, to form a business identity with high-added value and achieve integrated business services adapted to the special characteristics of the area. The action plan for this project was to actively search for new markets, create a collective identity for the products, promote their quality and added value, engage in gastronomes and tasting exhibitions, dissemination and publicity actions, as well as enhance the quality of the products and markets based on the customer needs. The primary focus of this publication is to observe and analyze the data retrieved from various tasting exhibitions of the AliAmbra project, with a target goal of improving customer experience and product quality.

Solid-state transformer (SST) is a promising technology for smart grids due to its flexible power control (better reliability) and high efficacy (by decreasing losses) compared with traditional transformers. The SST is designed in tandem with three stages, i.e., the input, isolation, and output stages. As three converter stages are used to design the SST to make a more reliable device in practice, it is highly prone to instabilities. Moreover, the key objective of SST design is to implement a modern power distribution system to make it more intelligent and reliable. The stability issue can be even more complicated by the presence of distributed energy resources in the distribution system. Thus, the stability of SST must be measured prior to /during the design, and to determine, a state-space model is used, which is developed in this paper. Each stage of SST is modeled with its controller, and the system's stability is measured through the controllability and observability test. Further, the conversion from state-space to transfer function model is done, and the stability of SST is shown using frequency and time-domain diagrams. With these, the different plots, namely, the Bode plot, Nyquist plot, Nichols chart, Root locus, pole-zero plot, and Eigen plot, are used to ascertain the relative and absolute stability. Finally, the SST Simulink model is tested and validated through hardwate-in-the-loop simulation, i.e., OPALRT, to show its effectiveness and applicability.

This article summarizes Chinese framework for regulating artificial intelligence and integrates evolutionary game theory with cost-benefit analysis to establish a model and simulation. This framework is employed to analyze the behavioral trends among three distinct entities: governmental bodies, third-party independent institutions, and AI companies within the context of regulatory relationship. The findings indicate that: (1) The cost-benefit dynamics within the regulatory legal nexus significantly influence the behaviors of these entities; (2) Under the condition of normalized government regulation approaching full enforcement, the behavioral choices of third-party independent institutions and AI companies exhibit cyclical fluctuations.The paper draws two principal conclusions: (1) The regulatory framework need to be tailored to the specific risks presented by AI and the relative costs and benefits of legal enforcement in different jurisdictions. (2) From a cost-benefit standpoint, government intervention in AI regulation ought to be circumscribed, with government regulation focusing on critical legal risks. Other aspects of regulatory control should be delegated to cooperative legal framework that allows the participation of the independent third-party institution,which brings a nuanced and specialized approach to the governance of AI.

The research presented in this paper examines a new proposed approach for identifying safety improvement sites on rural highways. Unlike conventional approaches, the proposed approach does not require crash history, but rather utilizes classified variables for traffic volume, geometric features, and roadside characteristics that do not require access to exact data or extensive technical expertise. The research validates the performance of the proposed approach using field data from a large sample of rural two-lane highway segments in the state of Oregon including traffic, roadway, and crash data. Using observed crash history as a reference, the performance of the proposed ap-proach was compared to two of the well-established methods in practice, namely: the Empirical Bayes (EB) and the Potential for Safety Improvement (PSI) methods. The study results suggest that, using crash density for highway segments, the performance of the proposed method was lower than that of the EB and PSI methods. This is despite the high R-square value of the predictive model used in the proposed method. However, when using crash frequencies for highway segments, the per-formance of the proposed method was found comparable to the well-established EB and PSI methods.

About half of the world's population is at risk of dengue infection. Epidemics of dengue fever caused an increased risk of morbidity and mortality in recent years, which led to the exploration of vaccines as a preventive measure. This systematic review and meta-analysis aimed to evaluate the efficacy, immune response, and safety of dengue vaccines in children by analyzing clinical trials. The review followed standard procedures for data extraction using PRISMA guidelines, and searching multiple databases including PubMed, CINAHL, Medline, Health Source, Science Direct, and Academic Search Premiere. Eligible studies involved children (0-17 years). Cochrane Collaboration criteria were used for quality assessment, with thematic data synthesis and meta-analysis. Among 38 selected studies, dengue vaccines showed varying efficacy against all four serotypes. CYD-TDV (Dengvaxia®), and Tekade (TAK-003) vaccines demonstrated strong protection against severe dengue, but their long-term efficacy varied. Vaccines triggered satisfactory immune responses, notably in those previously exposed to dengue. Safety profiles were mostly favorable, noting mild adverse events post-vaccination. Meta-analysis supported vaccine efficacy and immune response, but safety concerns warrant further exploration. In conclusion, dengue vaccines demonstrated promising efficacy and immune response, particularly against severe manifestations.

Heterosis plays a significant role in enhancing variety, boosting yield, and raising economic value, but the molecular mechanism is still unclear. We analyzed the transcriptomes and 3D genomes of hybrid (F1) and its parents (w30 and 082). Analysis of the expression revealed a total of 485 specially expressed genes (SEGs), 173 differentially expressed genes (DEGs) above parental expression level, more actively expressed genes and up-regulated DEGs in F1. Further study revealed that the DEGs detected in F1 and its parents were mainly involved in response to auxin, plant hormone signal transduction, DNA metabolic process, Purine metabolism, starch and sucrose metabolism, which suggested that these biological processes may play a crucial role in the heterosis of B. rapa. The analysis of 3D genome data revealed that hybrid F1 tend to contain more transcriptionally active A compartments after hybridization. Additionally, F1 had a smaller TAD (topologically associated domain) genome length, but the number was the highest, and the expression change of activated TAD was higher than repressed TAD. More specific TAD boundaries were detected between parents and F1. Subsequently, 140 DEGs with genomic structural variants were selected as potential candidate genes. Among them, we found two DEGs with consistent expression changes in A/B compartments and TADs. Our findings suggest that genomic structural variants, such as TADs and A/B compartments, may affect gene expression and contribute to heterosis in B. rapa. This study provides further insight into the molecular mechanism of heterosis in B. rapa.

The soils of the high-altitude mountains along the East African Rift Valley are poorly understood. Understanding the potential of soils for agriculture, climate change mitigation, and environmental functioning necessitates an understanding of their relationship to soil-forming factors. Therefore, this study focuses on the volcanic soils of Mount Guna. Eighty-five soil profiles, between 3000 and 4120 m a.s.l., were described and sampled along seven topographic transects. The samples were analyzed for physicochemical characteristics using standard methods and classified according to WRB 2022. The clay mineralogy of six profiles was analyzed with X-ray diffraction. The first four-factor axes, which are related to elevation, parent material, climate, and land use were found by factor analysis, explaining more than 60% of the total variation. The clay portions are primarily composed of trioctahedral chlorite, trioctahedral mica (phlogopite or biotite), vermiculite, kaolinite, some quartz, some amorphous silicates (most likely pyroclastic glass), and minor feldspar. The presence of weatherable minerals (biotite, amphibole, feldspars, and so on) suggests that these soils have not been weathered extensively. The dominant Reference Soil Groups found in the study area are Andosols, Phaeozems, Leptosols, Regosols, Cambisols, Luvisols, and Vertisols. As a result, our findings suggest that altitudinal variation, climate, lithology, and their contributions to the variability of soil characteristics and development along the toposequence cannot be separated in this study; more similar studies in other high-elevation/altitude mountains are required. There have been no other studies of high-altitude mountains in East Africa where so many soil profiles have been examined.

This study investigates the suitability of the timestamp approach algorithm for predicting blood pressure (BP) using wearable and comfortable devices, showcasing its accuracy even with low-frequency sampled signals. Developed within the SINTEC European project, the algorithm utilizes Electrocardiogram (ECG) and Photoplethysmogram (PPG) sensors, demonstrating promising results in both laboratory and hospital settings. The research emphasizes the algorithm’s potential to transform continuous and non-invasive BP monitoring through wearable technology, offering frequent measurements with minimal discomfort. While the study shows promise, further exploration is needed, focusing on optimizing machine learning coefficients for long-term monitoring applications and addressing potential changes over time. Technological improvements, including the implementation of edge computing algorithms, hold the key to enhancing BP accuracy, denoising techniques, and integrating alarm systems for future wearable solutions. This study emphasizes the adaptability of the algorithm for diverse healthcare environments, paving the way for broader applications in convenient and reliable BP monitoring.

(1) Background: There is a need to assess the availability of essential antimicrobials as the availability of an antimicrobial is a critical element of its rational use. We aimed to assess the availability of antimicrobials listed in National List of Essential Medicines 2015, India (primary list) and a selected (secondary) list comprising of agents indicated for commonly encountered infectious illnesses in various healthcare settings and to identify the reasons for their non-availability. (2) Methods: A cross-sectional survey of 25 public, private, and other sector pharmacies was carried out in Rohtak, a district of North Indian state of Haryana, from April to June 2022. (3) Results: Most of the antimicrobials surveyed were optimally available in various sector pharmacies with the exception of benzathine benzyl penicillin, benzyl penicillin, cloxacillin, cefazolin, cefuroxime, cefadroxil, amphotericin B and antimalarials. Most frequent reasons for limited availability were low demand, no prescriptions and non-listing of drugs in state essential medicine list. (4) Conclusions: Enough evidence needs to be generated with respect to status of availability of essential antimicrobials from different regions of India as well as other lower-middle income countries to devise measures for ascertaining better availability of these agents especially antibiotics at regional, national and global scales.

In this paper, we present a groundbreaking methodology in the realm of aspect-level sentiment analysis, which capitalizes on the advanced capabilities of graph-based neural networks. Our approach, distinguished as the Aspect Correlation Graph Network (ACGN), represents a significant departure from conventional models. These traditional models often analyze aspects in isolation, failing to capture the intricate web of sentiment relationships that may exist within a single sentence. ACGN, however, is designed to address this gap by employing a sophisticated bidirectional attention mechanism, integrated with positional encoding. This unique combination not only enhances the model's ability to focus on relevant parts of the sentence but also aids in constructing detailed, aspect-focused representations. These representations are particularly crucial for understanding the nuanced interplay of sentiments associated with different aspects. Central to our model's architecture is the incorporation of a graph convolutional network. This network serves as a pivotal component in mapping and analyzing the complex network of sentiment correlations that can exist among various aspects within sentences. Through this integration, ACGN is able to unearth and interpret the subtle and often overlooked sentiment dynamics that traditional models might miss. Our comprehensive evaluations of the Aspect Correlation Graph Network, conducted using the SemEval 2014 datasets, have yielded promising results. These findings demonstrate a clear and significant advancement over the capabilities of existing models. Particularly, the results underscore the critical importance and utility of recognizing and understanding the connections between sentiments of different aspects in text analysis. This insight opens new avenues in the field of sentiment analysis, suggesting a broader application potential of ACGN in various contexts where understanding nuanced sentiment relationships is key. Overall, our study not only introduces a novel approach in aspect-level sentiment analysis but also sets a new standard for future research in this area. By highlighting the integral role of inter-aspect sentiment connections, ACGN paves the way for more sophisticated and accurate sentiment analysis tools, capable of handling the complexities of natural language with greater finesse and precision.

In this paper, we delve into the realm of aspect-level sentiment analysis, a sophisticated analytical task focused on pinpointing and interpreting the sentiment directed towards specific elements within a sentence. Traditional methods in this domain, primarily based on neural networks, have often overlooked the critical role of syntactic structures in sentences. To bridge this gap, we have developed the Syntax-Enhanced Sentiment Graph Network (SentiSyn). This pioneering model represents a significant step forward in aspect-level sentiment analysis, bringing to the forefront the utilization of word dependency relationships to enrich sentiment analysis. SentiSyn stands out by its innovative use of a dependency graph, a tool that meticulously maps out the intricate web of syntactic relationships surrounding a target aspect in a sentence. This approach allows SentiSyn to effectively capture and channel sentiment-related characteristics that are deeply rooted in the syntactic context of the aspect target. By doing so, SentiSyn unlocks a deeper understanding of sentiment dynamics in textual content, enabling a more nuanced and accurate sentiment analysis. Our comprehensive experimental evaluation of SentiSyn showcases its remarkable capabilities. When combined with advanced embedding techniques like GloVe and BERT, SentiSyn demonstrates a superior performance edge over several existing sentiment analysis methods. This performance leap is not just incremental; it represents a significant enhancement in the field of sentiment analysis, underscoring the importance of syntactic context in understanding sentiments. Furthermore, our analysis delves into how SentiSyn effectively leverages these embeddings to gain a more profound and contextually rich insight into sentiment dynamics. The results from our tests indicate that SentiSyn, with its unique approach to integrating syntactic structures and advanced embeddings, sets a new benchmark in aspect-level sentiment analysis, offering both enhanced accuracy and deeper sentiment understanding.

It is well known that the basis of diffraction analysis of matter is scattering, including scattering of ultrashort laser pulses. In the theory of scattering of ultrashort pulses the pulse duration parameter is usually not taken into account, which leads to some error. This error may be more significant than the considered effects in the scattering of the pulse on the studied structure. In this paper it is shown that the pulse duration parameter should be taken into account when scattering X-ray pulses on oriented diamonds with NV-centers. It is shown that the scattering spectra can be used to judge the orientation of NV centers in the diamond structure. The obtained results may be very different from the widely used theory of diffraction analysis, which confirms the necessity of taking into account the pulse duration parameter in the diagnosis of complex structures.

High-throughput research on bimetallic nanoparticles brought a vast overview of their characteristics and catalytic activities.¹ However, traditional bimetallic nano-allloy quantification methods serving catalyst preparations are not suitable for the fast and robust data output of high-throughput experiments. Hence, this work designed and validated a more fast, more neat, and reliable quantitative analysis using X-ray fluorescence spectroscopy for bimetallic nanoparticles synthesized by high-throughput setups. The results demonstrated this method to be accurate with high precision. Furthermore, the agreement to qualitative results from an energy-dispersive X-ray spectrometer equiped on a scanning electron microscope provided an option to quantify a bimetallic nano-alloy by just analyzing one of the two composing elements. Thus, this method is proved to be highly compatible with high-throughput experiments.

Ransomware attacks have risen alarmingly, with encryption techniques becoming more complex. This paper introduces a novel detection model tailored for ransomware's distinctive characteristics. The Intel PIN tool extracts Windows API invocation sequences related to file operations. These sequences are used to construct n-grams, forming feature vectors enhanced by a new Class Feature Weighting (CFW) metric to improve malware detection. Preliminary results demonstrate elevated accuracy and precision versus existing methods. The major contributions are: (1) Introducing an innovative deep learning model for few-shot ransomware classification using entropy features and transfer learning. (2) Achieving high weighted F1-score in classifying ransomware variants into families with limited training data. (3) Demonstrating the potential of entropy-based features to capture intricacies lost in image-based approaches, improving detection of new strains.

Chronic Low Back Pain (CLBP), defined as pain persisting for at least 12 weeks, is a significant public health issue, with prevalence intensifying due to an ageing global population, amassing approximately 619 million cases in 2020 and projected to escalate to 843 million by 2050. Given the multitude of therapeutic modalities available for CLBP, this research sought to ascertain their respective efficacies in ameliorating pain and disability. We specifically scrutinized Multidisciplinary Biopsychosocial Rehabilitation (MBR) among adults enduring non-specific low back pain for over 12 weeks, excluding acute pain conditions and pre-study surgical interventions. MBR is an approach encompassing various modalities, including exercise, behavioral therapies, educational programs, and work conditioning aspects, necessitating a comprehensive Network Meta-Analysis (NMA) to fully grasp the extensive scope of its impact. The constructed network comprised diverse MBR modalities (behavioral, educational, and work conditioning) alongside exercise therapy (ET), minimal intervention, and usual care, serving as controls with pain and disability as outcomes. Through the analysis of 4,619 initially identified studies, 93 were included, encompassing a total of 8,059 participants. The NMA conducted substantiated that both ET and MBR modalities were notably effective in alleviating CLBP, with education-oriented MBR emerging as the most efficacious for pain mitigation and behavior-focused MBR for disability reduction. Nevertheless, the discerned differences amongst the treatments were minimal and uncertain, highlighting that no modality was definitively superior to the others. The analysis revealed low global and local inconsistency within the network, underscoring the reliability of the observed outcomes. Given the intricate nature of CLBP, embodying various facets, our findings advocate for a combined therapeutic approach to optimize treatment efficacy. Nonetheless, the presence of high study heterogeneity and potential biases necessitates cautious interpretation of the results, prompting future research.

This study involved a comprehensive examination of sensory attributes in Bísaro dry-cured loins, including odor, androsterone, scatol, color, fat color, hardness, juiciness, chewiness, flavor intensity, and flavor persistence. Analysis of 40 samples revealed a wide variation in these attributes, ensuring a robust margin for multivariate calibration purposes. The respective near-infrared (NIR) spectra unveil distinct peaks associated with significant components such as protein, lipid, and water. Support Vector Regression (SVR) models were methodically calibrated for all sensory attributes, with optimal results using multiplicative scattering correction pre-treatment, MinMax normalization, and radial base kernel (non-linear SVR model). The predictive models exhibited acceptable results, characterized by R-squared values close to 1 (0.9616 - 0.9955) and low RMSE values (0.0400 – 0.1031). The prediction set's relative standard deviation (RSD) remained under 5%. Comparisons with prior research revealed significant improvements in prediction accuracy, particularly when considering attributes like pig aroma, hardness, fat color, and flavor intensity. This research underscores the potential of advanced analytical techniques to improve the precision of sensory evaluations in food quality assessment.

Computer vision is a powerful technology that has enabled solutions in various fields by analyzing visual attributes in images. One field that has taken advantage of computer vision is agricultural automation, which promotes high-quality crop production. The nutritional status of a crop is a crucial factor in determining its productivity. This status is mediated by approximately 14 chemical elements acquired by the plant, and their determination plays a pivotal role in farm management. To address the timely identification of nutritional disorders, this study focuses on the classification of three levels of phosphorus deficiencies through individual leaf analysis. The methodological steps include: (1) generating a database with laboratory-grown maize plants that were induced to total phosphorus deficiency, medium deficiency, and total nutrition, using different capture devices; (2) processing the images with state-of-the-art transfer learning architectures (i.e. VGG16, ResNet50, GoogLeNet, DenseNet201, and MobileNetV2); and (3) evaluating the classification performance of the models using the created database. The results show that the VGG16 model achieves superior performance, with 98% classification accuracy. However, the other studied architectures also demonstrate competitive performance and are considered state-of-the-art automatic leaf deficiency detection tools. The proposed method can be a starting point to fine-tune machine vision-based solutions tailored for real-time monitoring of crop nutritional status.

Driven by industrialization and urbanization, urban air pollution can increase respiratory, heart, and cerebrovascular diseases, and thus mortality rates; as such, it is necessary to improve air quality through the consideration of individual pollutants and emissions sources. In South Korea, national and local governments have installed urban and roadside air quality monitoring systems. However, stations are lacking outside metropolitan regions, and roadside stations are sparsely distributed, limiting comparisons of pollutant concentrations with vehicle traffic and floating population levels. Local governments have begun using mobile laboratories (MLs) to supplement the fixed measurement network and investigate road pollution source characteristics based on their spatiotemporal distribution; however, the collected data cannot be used effectively if they are not visualized. Here, we propose a method to collect and visualize global information system (GIS)-based air quality data overlayed with environmental variables to support air quality management measures. Spatiotemporal analyses of ML-derived data from Bucheon, Korea, confirmed that particulate and gaseous pollutant concentrations were high during typical commuting hours, at intersections, and at a specially managed road. During commuting hours, the maximum PM10 concentration reached 200.7 µg/m³ in the Nae-dong, Gyeongin-ro, and Ojeong-dong ready-mix concrete complex areas, and the maximum PM_2.5 concentration was 161.7 µg/m³. The maximum NOx, NO₂, and NO levels of 1.34 ppm, 0.18 ppm, and 1.18 ppm, respectively, were also detected during commuting hours. These findings support the need for targeted management of air pollution in this region, and highlight the benefit of comprehensively comparing road levels, driving speed, and traffic levels when identifying hotspots of air pollution. Such analyses will contribute to the development of air quality management measures customized to regional characteristics.

Currently, most plastic waste stems from packaging materials, with a large proportion of this waste either discarded or used to derive fuel. Accordingly, there is growing interest in the use of pyrolysis in the context of chemically recycling non-recyclable (i.e., via mechanical means) plastic waste into petrochemical feedstock. The aim of this study is to use kinetic analyses to elucidate the pyrolytic properties of solid recovered fuel (SRF) produced using two types of reactors, namely, fixed bed and fluidized bed reactors. From the kinetic analysis, the activation energy corresponding to the rate of pyrolysis reaction conversion was obtained. In conclusion, we found that the pyrolysis occurs more vigorously in fluidized bed reactors compared to fixed bed reactors.

Audio recording in classrooms is a common practice in educational research, with applications ranging from detecting classroom activities to analysing student behaviour. Previous research has employed neural networks for classroom activity detection and speaker role identification. However, these recordings are often affected by background noise that can hinder further analysis, and the literature has only sought to identify noise with general filters and not specifically designed for classrooms. Although the use of high-end microphones and environmental monitoring can mitigate this problem, these solutions can be costly and potentially disruptive to the natural classroom environment. In this context, we propose the development of a neural network model that can specifically detect and filter out background noise in classroom recordings. This model would allow the use of lower quality recordings without compromising analysis capability, thus facilitating data collection in natural educational environments and reducing the costs associated with high-end recording equipment.

Modular high-rise buildings frequently adopt cast-in-place concrete to ensure building integrity. To reduce the material consumption and realize mold-free casting, a 30 mm thick light concrete mold shell wall panel ( MiC wall panel) is set as part of the shear wall. But the concrete casting process is prone to cracking and rising pattern. Its force performance and damage mechanism is not clear. To this end, this paper designs three groups of MiC wall panels with different material component types. The static load test is carried out in a graded partitioned loading mode. The effects of different material components on the mechanical properties of MiC wall panels are systematically investigated and parametrically analyzed by numerical simulation. The results show that the front cracks of the wall slab are mainly distributed under the truss tendons, and the back cracks are mainly distributed in the span position of the adjacent truss tendons. They are both along the span direction of the wall slab. Increasing the strength level of concrete and using steel fiber concrete can improve the mechanical properties of MiC wall panels to different degrees. Among them, increasing the concrete strength has a significant effect on improving the load-bearing capacity of wall panels, while incorporating steel fibers can significantly improve the deformation and crack resistance of wall panels. By building more finite element models, it was verified that the steel fiber admixture has limited effect on the mechanical properties of wall panels as the concrete grade increases. This study aims to summarize the types of wall panels with the best working properties. It provides a practical basis for optimizing the production and fabrication process of MiC wall panels.

Background and Objectives: Clinical trials are a critical step in the development of new medicines and medical devices, testing the efficacy and safety of new treatment regimens. However, if the results of clinical trials are not made public, the evidence base on interventions is incomplete and possibly distorted, which lead to suboptimal treatment choices and negatively affect public health. This study analyses and contrasts the laws and regulations governing clinical trial registration and reporting in China and the United States. Methods: We used desk research to compile, assess and compare current laws, regulations, compliance patterns, and enforcement mechanisms and actions in China and the United States (U.S.). Policy documents were downloaded from Chinese and U.S. government websites. A spreadsheet analysis was utilized for direct comparison. Results: Both China and the U.S. have laws and regulations governing clinical trial registration and reporting. Chinese legislation covers a broader range of trials. In the U.S. trial results must be disclosed to both the national regulator and the public, while Chinese law mandates disclosure to the regulator alone. Cross-country comparisons of regulatory compliance by trial sponsors are impossible due to the opacity of the Chinese data platform. Neither country effectively ensures that all clinical trial results are made public as required by the Declaration of Helsinki and recommended by the WHO. Interpretation: While neither country is perfect, both may be able to learn from each other. There is a major gap in the literature regarding the extent of non-publication of clinical trial results by sponsors operating in China.

Collaborative robots (cobots) have largely replaced conventional industrial robots in today’s workplaces, particularly in manufacturing setups due to their improved performance and intelligent design. In the framework of Industry 5.0, humans are working alongside cobots to accomplish the required level of automation. However, human-robot interaction has brought up concerns regarding human factors (HF) and ergonomics. A human worker may experience cognitive stress as a result of cobots' irresponsive nature in unpredictably occurring situations, which adversely affects productivity. Therefore, there is a necessity to measure stress to enhance a human worker’s performance in a human-robot collaborative environment. In this study, factory workers’ mental workload has been assessed using physiological, behavioural, and subjective measures. Electroencephalography (EEG) and functional near-infrared spectroscopy (fNIRS) signals have been collected to acquire brain signals and track hemodynamic activity, respectively. The effect of task complexity, cobot’s movement speed, and cobot’s payload capacity on the mental stress of a human worker have been observed, for a task designed in the context of a smart factory. Task complexity and cobot’s speed have proved to be more impactful. As physiological measures are unbiased and more authentic means to estimate stress, eventually, they may replace the other conventional measures if they prove to correlate with the results of traditional ones. Here, regression and artificial neural networks (ANN) have been utilised to determine the correlation between physiological data and subjective and behavioural measures. Regression has performed better for most of the targets and the best correlation (rsq-adj = 0.654146) has been achieved for predicting missed beeps, behavioural measure, using a combination of multiple EEG and fNIRS predictors. The k-nearest neighbours (KNN) algorithm has been used to evaluate the accuracy of correlation between traditional measures and physiological variables, with highest accuracy of 77.8% achieved for missed beeps as the target. Results show that physiological measures can be more insightful and have the tendency to replace other biased parameters.

Zambia recently experienced extended hours of load shedding due to reduced hydroelectricity generation attributed to poor rainfall patterns. The inability to meet energy demand has influenced the government to consider alternative energy sources. This study aims to assess the economic feasibility of the eight sites using a 25-turbine layout for a 4 MW generic wind turbine at 130m hub height. An economic evaluation mathematical model was developed to analyze the economic feasibility using net present value, simple payback period, internal rate of return, and levelized cost of electricity (LCOE). The study shows that the Lusaka wind farm was the most economical with 386 GWh energy yield analysis (EYA), wind speed of 8 m/s, NPV of 316 million dollars, SPP of 2.9 years, IRR of 82%, and LCOE of $0.182/ kWh. The results also show that the other seven sites are economically feasible, with Petauke being the lowest. The study's economic sensitivity analysis conducted by varying the average electricity tariff shows that Lusaka was the most financially viable site. Therefore, policymakers should develop cost-reflective feed-in tariff (FiT) schemes and power purchase agreements for the country to have cost-reflective electricity tariffs that will motivate independent power producers to invest in Zambia.

In South Korea, demolition waste (DW) management has become increasingly significant owing to the rising number of old buildings. Effective DW management requires an efficient approach that accurately quantifies and predicts the generation of DW (DWG) of various types, which necessitates access to the required information or technology capable of achieving this. Hence, we developed an artificial intelligence-based model that predicts the generation of ten DW types, specifically from buildings in redevelopment areas. We used an artificial neural network algorithm with < 10 neurons in the hidden layer to derive individual input variables and optimal hyperparameters for each DW type. All DWG prediction models achieved an average validation and test prediction performance (R²) of 0.970 and 0.952, respectively, with their ratios of percent deviation ≥ 2.5, ver-ifying them as excellent models. Moreover, a Shapley additive explanations analysis revealed that DWG was most impacted by the floor area for all the DW types, with a positive correlation with DWG. Conversely, other factors showed either a positive or negative correlation with DWG de-pending on the DW type. The study findings will enable demolition companies and local gov-ernments in making informed decisions for efficient DW management and resource allocation by accurately predicting the generation of various types of DW.

Background Most of the Leber hereditary optic neuropathy (LHON) cases are bilateral and sequential, how-ever there are rare unilateral examples, or those in which the delay of onset of vision loss between one and the other eye is longer. In the case of presumed childhood amblyopia in one eye, the vision loss in the good eye may be the only symptom of bilateral disease, that was unnoticed in previ-ously amblyopic eye, or a preexisting episode of LHON on the “amblyopic” eye. Clinical decision in such cases may be difficult and suggestive for other forms of atypical optic neuropathy until confirmed by genetic testing. Case series We present three genetically confirmed (MT-ND1:m.3700G>A, MT-ND6:m14484 T>C, and MT-ND4:m.11778G>A) patients with subacute vision loss in previously good eye with the other eye believed to be amblyopic from the childhood, and their features different of what would be expected in true amblyopia. In all, electrophysiology testing showed bilaterally reduced ampli-tude of PERG with low VEP P100 wave amplitudes and prolonged peak time in both eyes, also unusual for amblyopia. During the follow-up, pallor of the optic discs progressed in all eyes. Significant thinning of the retinal nerve fiber layer around the optic disc (pRNFL) and ganglion cell complex (GCC) in the macular region was present. All three patients had peculiar history. First patient was treated for presumed hyperopic amblyopia that did not improve since child-hood and experienced visual loss on the good eye at the age of 17 and was negative for the three typical LHON mutations. Extended testing confirmed atypical pathogenic variant MT-ND1:m.3700G>A in homoplasmy. The second patient with presumed strabismic amblyopia had unusual presentation of vision loss only at the age of 61 and after exclusion of other causes, typical MT-ND4:m.11778G>A pathogenic variant was found in homoplasmy. The third case was peculiar as he had presumed strabismic amblyopia since childhood and had some degree of disc pallor in the amblyopic eye upon presenting with loss of vision on the good eye at the age of 21 and typical pathogenic variant m14484 T>C, p.Met64Val was subsequently confirmed. However, one year after the disease onset, he started to experience significant spontaneous functional im-provement in the non-amblyopic up to 1.0 Snellen, whilst improvement in the presumed amblyop-ic eye was modest, suggesting preexisting amblyopia. This interestingly extensive improvement was carefully followed by electrophysiology as well as visual acuity and fields. Conclusion This report shows three different scenarios of presentation of LHON in patients with presumed uniocular amblyopia from childhood. In such cases, the diagnosis may be difficult and detailed structural and functional evaluation of the optic nerve head is necessary to assess whether earlier LHON episode was misdiagnosed as amblyopia or whether LHON presented bilaterally on both eyes whilst only being noticed in the previously good eye.

A major challenge of augmented and mixed reality applications is identifying the context and semantics of the real environment. Studies on object and action recognition were developed based on the improvement of machine learning techniques, allowing them to be annotated and recognized. This study aims to characterize current knowledge on the use of machine learning for recognizing objects and actions in augmented and mixed reality environments, increasing context awareness. Therefore, a systematic literature review of works related to these topics was made, using the Scopus and Web of Science knowledge bases. We searched articles and conference reviews or papers published between 2018 and 2022 and selected fifteen studies to be reviewed. The results indicate that there is a great demand for using machine learning to immersive technologies in factories, engineering, entertainment, education, health, among other application domains. However, these real-time interactive systems still have challenges and limitations to be solved, involving network communication, prediction time and the creation of a model that recognize objects and actions in broad contexts. Furthermore, additional research is needed to investigate how object and action recognition can increase context awareness in augmented reality applications.

A mixture of nonlabeled (14N2H4) and 15N labeled hydrazine (15N2H4) in an aqueous solution is oxidized to 15N2, 14N2, and 14N15N molecules, indicating the intermediate existence of the 14NH2-14NH-15NH-15NH2 with subsequent hydrogen transfers and splitting of side N-N bonds. Structures, thermodynamics, and electron characteristics of various N4H6 molecules in aqueous solutions are investigated using theoretical treatment at the CCSD/cc-pVTZ level of theory to explain the crucial part of the hydrazine oxidation reaction. Most N4H6 structures in aqueous solutions are decomposed during geometry optimization. Splitting the bond between central nitrogen atoms is the most frequent, but the breakaway of the side nitrogen is energetically the most preferred. The N-N fissions are enabled by suitable hydrogen rearrangements. Gibbs free energy data indicate the dominant abundance of NH3... N2... NH3 species. The side N atoms have very high negative charges, which should support hydrogen transfers in aqueous solutions. The only stable cyclo-(NH)4…H2 structure has a too high Gibbs energy and breaks the H2 molecule. The remaining initial cyclic structures are split into hydrazine and HN≡NH or H2N≡N species, and their relative abundance in aqueous solutions is vanishing.

An important indicator of human-related pollution in watersheds is dissolved oxygen (DO). The DO is highly dependent on both space and time characteristics of the watershed and is directly linked to eutrophication, which impairs the development of both the aquatic fauna and flora, also negatively impacting the water quality. Aspiring to reach a more accurate and precise forecasting approach to predict levels of DO, the present work proposes new graph-based and transformer-based deep learning models. The models were trained and validated for the Credit River Watershed, and the results were compared with both benchmarking and literature-found approaches. The proposed Graph Neural Network Sample and Aggregate (GNN-SAGE) model was the best-performing approach, reaching coefficient of determination (R2) and Root Mean Squared Error (RMSE) values of 97% and 0.34 ppm, respectively. The findings from the Shapley additive explanations (SHAP) indicated that the GNN-SAGE benefited from spatiotemporal information from the surrounding stations, improving the model’s results, and that temperature is a major input attribute for determining future DO levels. The results established that the proposed GNN-SAGE model stands as a state-of-the-art solution for DO forecasting, with potential for real-time water quality applications.

The study within the current research is focused on theoretical assessment of sustainable aviation fuels (SAF) obtained by blending traditional jet fuels Jet A and different liquids (biodiesel and alcohols) from analytical point of view. Within this paper in-depth analysis ofthe physical-chemical properties of Jet A fuel blended with different biodiesels and alcohols has been performed. Also within the blends Aeroshell 500 oil has been added (5% vol.) for ensuring the lubrication of the turbo engine. The blends consists of: Jet Aaviation fuel + biodieselfrom: palm oil, pork fat, sunflower oil and alcohols: methanol, ethanol and butanol. All the 6 liquids have been blended with Jet A in the following percentages: 10, 20 and 30%. Flash point, kinematic viscosity, density, freezing point, elemental analysis and FTIR analysis have been performed for all the liquids: Aeroshell 500, jet A, jet A + 10, 20, 30% biodiesel from waste palm oil, pork fat and waste sunflower oil, jet A + 10, 20, 30% methanol, ethanol and butanol, biodiesels and alcohols. The obtained results shows the influence of each of the blend’s components on the physical-chemical properties of the blends. Based on the physical-chemical analysis of the blends, conclusions on the behavior of the blends during burning and the gaseous pollutants resulting from the burning process can be drawn.

In this study, three new demountable joints consisting of reinforced concrete columns and steel beams were proposed and their seismic performance was investigated using cyclic loading tests. The test results demonstrated that the three demountable RCS joints had good seismic performance. Using the finite element software ABAQUS, the influence of parameters such as beam flange thickness, bolt strength, and connector steel strength on the seismic performance of each joint was analyzed, and the influence of different parameters on the seismic behavior of the joint was determined. The results also showed that the three demountable RCS joints were sensitive to changes in the thickness of the steel beam flange, while the connector steel strength and bolt type had little impact on the joint's capacity. Additionally, shear capacity calculation formulas for the joint core area provided by different codes and researchers were compared with test and finite element results. The results showed that the calculation results of the ASCE guidance method, the Nishiyama method, and the CECS 347-2013 method were higher than the test values, while the calculation results of the Para method were lower because it did not consider the contribution of the cylindrical steel plate to the shear capacity of the joint core area.

This study aims to develop an auditory experience evaluation questionnaire to improve the presence of metaverse environments, and to derive evaluation components considering auditory presence and auditory user experience (AUX) through a survey. After conducting a survey with a total of 232 participants, five evaluation components were extracted from auditory presence and AUX evaluation factors through principal component analysis (PCA) and reliability analysis (RA): 'realistic auditory background', 'acoustic aesthetics', 'consideration of acoustic control and accessibility', 'auditory utility and minimalist design', and 'auditory consistency'. In particular, although AUX evaluation factors such as 'ease of access to sound control' have limitations in improving the sense of presence, negative factors of presence such as 'distraction due to sound' can be improved by utilizing AUX evaluation factors, so it is judged that the sense of presence in the metaverse environments can be improved by enhancing the auditory sense of presence and AUX evaluation factors according to the composition of the five evaluation components derived in this study. This study can be used as a basis for developing an auditory experience evaluation questionnaire for the metaverse platform, creating sound design guidelines, and identifying sound development priorities.

The natural units of measure lauded by Max Planck more than 100 years ago are rarely used today. But many physical constants, including Planck's constant, the gravitational constant, the speed of light, vacuum permittivity, and vacuum permeability, consist of natural units in their unit dimensions. The natural units are present in all formulas containing these constants. The defining characteristic of the natural units is an alignment of unit values at the Planck scale. This alignment gives a computational basis of proportionality from which the correlated properties and dynamics of elementary particles, including wavelength, period, mass, momentum, and energy, manifest in equal or inversely proportional ratios of the Planck scale. These correlations explain many of the defining equations of quantum mechanics, classical gravity, and electromagnetism.

In Saudi Arabia’s mountainous regions, debris flow is a natural hazard that poses a threat to infrastructure and human lives. To assess the potential zones of debris flow in the Al-Hada Road area, a study was conducted using Geographic Information System (GIS) analysis and remote sensing (RS) data. The study took into account various factors that could affect debris flow, such as drainage density, elevation, slope, precipitation, land use, geology, soil, and aspect. The study also included a field trip to identify 11 previous debris flow events that were influenced by high-density drainage and slope. The study utilized weighted overlay analysis in a GIS environment to create a map indicating the potential debris flow zones in the area. According to the analysis, low-risk areas cover 35,354,062.5 square meters, medium-risk areas cover 60,646,250 square meters, and high-risk zones cover an area of 8,633,281 square meters. This result was verified using the locations of previous debris flow events. The study’s findings can help planners and decision-makers identify and prioritize areas for mitigation and prevention measures. Additionally, the study contributes to understanding debris flow hazards in arid and semi-arid regions.

Recent studies suggest that PEBP1/RKIP and YY1, despite having distinct molecular functions, may interact and mutually influence one another's activity. They exhibit reciprocal control over each other's expression through regulatory loops, prompting the hypothesis that their interplay could be pivotal in cancer advancement and resistance to drugs. To delve into this interplay's functional characteristics, we conducted a comprehensive analysis using bioinformatics tools across a range of cancers. Our results confirm the association between elevated YY1 mRNA levels and varying survival outcomes in diverse tumors. Furthermore, we observed differing degrees of inhibitory or stimulatory effects of these two genes in various cancer pathways, along with correlations between their mRNA expression and immune infiltration. Additionally, YY1/PEBP1 expression (or methylation) displayed connections with genomic alterations across cancer types. Notably, we uncovered links between YY1/PEBP1 and different indicators of immunosuppression, such as immune checkpoint blockade response, and T-cell dysfunction/exclusion levels, across different patient groups. Overall, our findings underscore the significant role of the interplay between YY1 and PEBP1 in cancer progression, influencing genomic changes, tumor immunity or the tumor microenvironment. Additionally, these two gene products appear to impact the sensitivity of anticancer drugs, opening new avenues for cancer therapy.

The concept of collecting data of people using a domestic space is not novel. However, the methods and processes used to decipher this raw data and transform it into useful and appropriate information (i.e., sequence, duration, and timing derived from domestic activities) have been challenging and the focus of many research groups. But how are the results of the decoded transposition received, interpreted and used by the various professionals (e.g., occupational therapists and architects) who consume the information? This paper describes the inclusive evaluation process undertaken, which involved architects, engineers and end-users (not the occupant, but the care team managing the occupant). Finally, our study evidence the importance of making accessible to a multidisciplinary audience spatial, temporal and sequential aspects derived from people's domestic routines. Shedding light on how a systematic approach to collecting, processing and mapping low-level sensor data into higher forms and representations can be a valuable source of knowledge for improving the domestic living experience.

Entrepreneurship education in South Africa holds significant promise in empowering the youth and fostering economic growth. This article explores the impact of entrepreneurship education on youth empowerment, focusing on case studies of successful young entrepreneurs, evaluation of entrepreneurial skills development, and analysis of employment and economic outcomes. While effective models of entrepreneurship education emphasize experiential learning and collaboration with local businesses, resource constraints and infrastructure gaps pose challenges. Moreover, socio-cultural perceptions and gender disparities influence youth's willingness to engage in entrepreneurship, hindering inclusivity. Evaluating the long-term impact remains challenging, requiring robust monitoring and evaluation mechanisms. The article concludes with recommendations to enhance the impact of entrepreneurship education, including increasing funding, challenging stereotypes, fostering collaboration, and developing evaluation mechanisms to support South Africa's youth in realizing their entrepreneurial potential.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.