Color change is the most obvious characteristic of tomato ripening stage and an important indicator of tomato ripening condition, which directly affects the commodity value of tomato. To visualize the color change of tomato fruit in mature stage, a gated recurrent unit network with an encoder-decoder structure that dynamically simulates tomato growth and development with time-dependent lines using tomato color and shape as real-time data was proposed in this paper. Firstly, the .json file was converted into a mask.png file, the tomato mask was extracted, and the tomato was separated from the complex background environment, and the tomato growth and development data set was successfully constructed. Then, a network of gated recurrent units with encoder-decoder structure was constructed to predict the future growth trend of tomato under different greenhouse temperatures. The experimental results showed that for the gated recurrent unit network of encoder-decoder structure proposed, when the hidden layer number was 1 and hidden layer number was 512, a high consistency and similarity between the model predicted image sequence and the actual growth and development image sequence would be realized, and the structural similarity index measure was 0.746. It was proved that when the average temperature was 24.93℃, the average soil temperature was 24.06℃, and the average light intensity was 11.26 Klux, the environment was the most suitable for tomato growth. The environmental data-driven tomato growth model was constructed to explore the growth status of tomato under different environmental conditions, thus to understand the growth status of tomato in time. The statement provided a theoretical foundation for determining the optimal greenhouse environmental conditions to achieve tomato maturity. And it offered recommendations for investigating the growth cycle of tomatoes, as well as technical assistance for standardized cultivation in solar greenhouses.

Magnetic resonance (MR) image acquisitions are usually time-consuming, limiting utilization in neuroimaging. For multiple sclerosis (MS) patients, MR imaging plays a major role in drug therapy decision-making. The purpose of this study was to evaluate whether an ultrafast, T2-weighted (T2w), deep-learning-enhanced (DL), echo-planar-imaging-based (EPI) fluid-attenuated inversion recovery (FLAIR) sequence (FLAIRUF) that has been targeting neurological emergencies so far might even be an option to detect MS lesions of the brain compared to conventional FLAIR sequences. Therefore, 17 MS patients were enrolled prospectively in this exploratory study. Standard MR protocols and ultrafast acquisitions were conducted at 3 tesla (T), including three-dimensional (3D)-FLAIR, turbo/fast spin echo (TSE)-FLAIR, and FLAIRUF. Inflammatory lesions were grouped by size and location. Lesion conspicuity and image quality were rated on an ordinal five-point Likert scale, and lesion detection rates were calculated. Statistical analyses were performed to compare results. Altogether, 568 different lesions were found. Data indicated no significant differences in lesion detection (sensitivity and positive predictive value [PPV]) between FLAIRUF and axially reconstructed 3D-FLAIR (lesion size ≥ 3 mm × ≥ 2 mm) and no differences in sensitivity between FLAIRUF and TSE-FLAIR (lesion size ≥ 3 mm total). Lesion conspicuity in FLAIRUF was similar in all brain regions except for superior conspicuity in the occipital lobe and inferior conspicuity in central brain regions. Further findings include location-dependent limitations of signal-to-noise ratio (SNR) and contrast-to-noise ratio (CNR) as well as artifacts such as spatial distortions in FLAIRUF. In conclusion, FLAIRUF could potentially be an expedient alternative to conventional methods for brain imaging in MS patients since the acquisition can be performed in a fraction of time while maintaining good image quality.

This study explores the impact of multi-user interaction, group work, and simulations within virtual worlds on language learning and the development of intergroup empathy. Two distinct research projects were conducted, involving a total of 241 participants aged 19-45. The language learning study engaged 116 participants in diverse interactive experiences, while the intercultural study had 125 participants collaborating in multicultural groups and participating in perspective-taking simulations. Both studies employed qualitative data collection methods, including surveys, interviews, and observations. The findings suggest that the combination of networking strategies, collaborative learning, and simulations within virtual worlds contributes to improvements in learners' language proficiency, confidence, and empathy towards diverse social groups. Participants reported increased motivation and engagement, attributed to the immersive and interactive nature of the virtual environments. The studies highlight the importance of collaboration and reflection in facilitating language acquisition and intercultural understanding. Technical challenges were identified as potential barriers to implementation. The results demonstrate the potential of virtual worlds to enhance language education and foster empathy in diverse societies, offering valuable insights for educators and researchers. However, the findings may be limited by the specific contexts and sample sizes of the studies, warranting further research to explore the generalizability and long-term impact of virtual world interventions. not exaggerate the main conclusions.

Surveys on the optimum seismic design of structures reveal that many investigations focus on how to minimize its initial cost while satisfying the performance constraints. Although reducing the initial cost while complying with the requirements of earthquake design codes of practice will significantly guarantee the life safety of occupants against earthquakes, it may still cause considerable economic losses to residents and fatalities. Accordingly, calculating the possible earthquake damages caused during the structure's lifetime may become essential from the optimal Life Cycle Cost (LCC) design point of view. LCC analysis is used to evaluate economic feasibility including construction, operation, occupancy, maintenance and end-of-life costs. For optimization, the population-based, meta-heuristic algorithm based on the Ideal Gas Molecular Movement (IGMM), has established its capability in solving highly nonlinear mono and multi-objective engineering problems. Therefore, this paper investigates the LCC -based mono and multi-objective optimum design of a 3-D four-story concrete building structure combined with the Endurance Time (ET) competence. The results show that, apart from substantially reducing the total number of analyses required, the proposed technique significantly affected dipping minor injury cost, rental, and income costs by 22%, 16%, and 16%, respectively. In total, a 10% reduction in all structural life-cycle costs was achieved, which could well be considered significant.

In recent decades, with the ever-growing scale of video data, near-duplicate videos continue to emerge. Data quality issue caused by near-duplicate videos is becoming more and more prominent, which has affected the application of normal videos. Although current studies on near-duplicate video detection can be helpful to uncover data quality issues for videos, they still lack a process of automatic merging for the video data represented by high-dimensional features, which are difficult to automatically clean the near-duplicate videos to improve data quality for video datasets. At present, there are few studies on near-duplicate video data cleaning. The existing studies have the sensitive problems of video data orderliness and clustering initial center under a condition that prior distribution is unknown, which seriously affect the accuracy of near-duplicate video data cleaning. To address the above issues, an automatic near-duplicate video data cleaning method based on a consistent feature hash ring is proposed in this paper. First, a residual network with convolutional block attention modules, a long short-term memory deep network, and an attention model are integrated to construct an RCLA deep network with the multi-headed attention mechanism to extract spatiotemporal features of video data. Then, a consistent feature hash ring is constructed, which can effectively alleviate the sensitivity of video data orderliness while providing a condition of near-duplicate video merging. To reduce the sensitivity of the initial cluster centers to results of near-duplicate video cleansing, an optimized feature distance-means clustering algorithm is constructed by utilizing a mountain peak function on a consistent feature hash ring, which can implement automatic cleaning of near-duplicate video data. Finally, experiments are conducted based on a commonly used dataset named CC_WEB_VIDEO and a coal mining video dataset. Compared with some existing works, simulation results demonstrate that the performance of the proposed method.

This study explores optimizing Synthetic Aperture Radar (SAR) satellite constellation scheduling for multi-imaging missions in densely targeted areas using an in-house developed Modified Dynamic Programming (MDP) algorithm. By employing Mixed-Integer Linear Programming (MILP) to define the mission planning problem, the research aims to maximize observation of high-value targets within restricted planning horizons. Numerical simulations, covering a wide range of target numbers and satellite configurations, reveal the MDP algorithm’s superior mission allocation efficiency, enhanced success rates, and reduced revisit times, compared to the Greedy algorithm. The findings underscore the MDP algorithm’s improved operational efficiency and planning robustness for complex imaging tasks, demonstrating significant advancements over traditional approaches.

The molecular basis of Down syndrome (DS) predisposition to leukemia is not fully understood but involves various factors such as chromosomal abnormalities, oncogenic mutations, epigenetic alterations, and changes in selection dynamics. Myeloid leukemia associated with DS (ML-DS) is preceded by a preleukemic phase called transient abnormal myelopoiesis driven by GATA1 gene mutations and progresses to ML-DS through additional mutations in cohesin genes, CTCF, RAS, or JAK/STAT pathway genes. DS-related ALL (ALL-DS) differs from non-DS ALL in terms of cytogenetic subgroups and genetic driver events and aberrant expression of CRLF2, JAK2 mutations, and RAS pathway activating mutations are frequent in ALL-DS. Recent advancements in single-cell multi-omics technologies have provided unprecedented insights into the cellular and molecular heterogeneity of DS-associated hematologic neoplasms. Single-cell RNA sequencing and digital spatial profiling enable the identification of rare cell subpopulations, characterization of clonal evolution dynamics, and exploration of the tumor microenvironment's role. These approaches may help identify new druggable targets and tailor therapeutic interventions based on distinct molecular profiles, ultimately improving patient outcomes with the potential to guide personalized medicine approaches and the development of targeted therapies.

Thermally-assisted-occupation density functional theory (TAO-DFT) has been an efficient electronic structure method for studying the ground-state properties of large electronic systems with multi-reference character over the past few years. To explore the time-dependent (TD) properties of electronic systems (e.g., subject to an intense laser pulse), in this work, we propose a real-time (RT) extension of TAO-DFT, denoted as RT-TAO-DFT. Besides, we employ RT-TAO-DFT to study the high-order harmonic generation (HHG) spectra and related TD properties of molecular hydrogen H2 at the equilibrium and stretched geometries, aligned along the polarization of an intense linearly polarized laser pulse. The TD properties obtained with RT-TAO-DFT are compared with those obtained with the widely used time-dependent Kohn-Sham (TDKS) method. In addition, issues related to the possible spin-symmetry breaking effects in the TD properties are discussed.

Introduction: The reduced implementation of surveillance programs and limited bedside infectious diseases consultations due to the pressure of COVID-19 pandemic in healthcare systems led to increased rates of irrational use of antimicrobials and incidence of infections by multidrug-resistant microorganisms. The aim of the present study is to evaluate the incidence of antimicrobial resistance and the management of bloodstream infections before and during COVID-19 pandemic at the University General Hospital of Alexandroupolis (Greece). Material-Methods: This is a retrospective study conducted from January 2018 to December 2022. Data were collected from the University Microbiology Laboratory per semester regarding the isolated strains of Gram positive and negative bacteria in blood cultures and respiratory samples in hospitalized patients in medical and surgical wards and in the Intensive Care Unit (ICU). Additionally, bloodstream infections with requested infectious diseases consultation were reported (n=400), determining whether these were carried out via telephone contact or at the patient's bedside. Demographic data, comorbidities, focus of infection, antimicrobial regimen, duration of treatment, length of hospitalization and clinical outcome were analysed. Results: A total of 4569 strains of Gram positive and negative bacteria were isolated. An increasing trend was reported compared to the pre-pandemic period in the incidence of resistant Gram-negative bacteria, particularly in ICUs. Prior antimicrobial use and the rate of hospital-acquired infections were increased significantly during the pandemic. In the pre-pandemic period 2018-2019, a total of 246 infectious diseases consultations were carried out, while during the period 2020-2022 154, with the percentage of telephone consultations 15% and 76% respectively. Detection of the source of infection and timely administration of appropriate antimicrobial agents were more frequently recorded before the pandemic and 28-day mortality was significantly reduced in cases with bedside consultations. Conclusion: Empowering of infectious diseases surveillance programs and committees, rational use of antimicrobials agents and bedside infectious diseases consultations are vital in order to reduce the impact of infections caused by multidrug-resistant strains.

The PLM concept implies the use of heterogeneous information resources at different stages of the product life cycle, the joint work of which allows you to effectively solve the problems of product quality and various costs. According to the principle of isomorphism of regularities of complex systems, an effective PLM system must have these regularities. Unfortunately, this principle is not often fundamental when designing PLM systems. The purpose of the work is to show, using a simple example, the principles of development, operation and use of an educational multi-agent PLM system, the main purpose of which is to study and research these regularities in the life cycle of a special threaded connection. The multi-agent approach to the development of a PLM system provides the necessary prerequisites for the emergence of system-wide regularities in it. The parallel work of agents is implemented using the actor model and the Ray Python-package. Agents for the logical inference of knowledge base facts, CAD/FEA/CAM/SCADA agents, agents for optimization by various methods, and other agents have been developed. Open source software was used to develop the system. Each agent has relatively simple behavior, implemented by its rule function, and can interact with other agents. The system can work in interactive mode with the user or in automatic mode according to a simple algorithm: the rule functions of all agents are executed until at least one of them returns a value other than None. Examples of the operation of the system are given and such system-wide regularities as emergence, historicity and self-organization are demonstrated in it.

Miscanthus holds a great potential in the frame of the bioeconomy and yield prediction can help improving Miscanthus logistic supply chain. Breeding programs in several countries are attempting to produce high-yielding Miscanthus hybrids better adapted to different climates and end-uses. Multispectral images acquired from unmanned aerial vehicles (UAVs) in Italy and in the UK in 2021 and 2022 were used to investigate the feasibility of high-throughput phenotyping (HTP) of novel Miscanthus hybrids for yield prediction and crop traits estimation. An intercalibration procedure was performed using simulated data from the PROSAIL model to link vegetation indices (VIs) derived from two different multispectral sensors. Random forest algorithm estimated with good accuracy yield traits (light interception, plant height, green leaf biomass and standing biomass) using VIs time series and predicted yield using peak descriptor derived from VIs time series with 2.3 Mg DM ha-1 of RMSE. The study demonstrates the potential of UAVs multispectral in HTP applications and in yield prediction for providing important information needed to increase sustainable biomass production.

The option of decarbonizing urban freight transport using Battery Electric Vehicle (BEV) seems promising.However, there is currently a strong debate whether Fuel Cell Electric Vehicle (FCEV) might be the bettersolution. The question arises as to how a fleet of FCEV influences the operating cost, the Greenhouse Gas(GHG) emissions and primary energy demand in comparison to BEVs and to Internal Combustion EngineVehicle (ICEV). To investigate this, we simulate the urban food retailing as a representative share of urbanfreight transport using a multi-agent transport simulation software. Synthetic routes as well as fleet size andcomposition are determined by solving a Vehicle Routing Problem (VRP). We compute the operating costsusing a total cost of ownership (Total Cost of Ownership (TCO)) analysis and the use phase emissions as wellas primary energy demand using the Well To Wheel (WTW) approach. While a change to BEV results in 17 -23% higher costs compared to ICEV, using FCEVs leads to 22 - 57% higher costs. Assuming today’s electricitymix, we show a GHG emission reduction of 25% compared to the ICEV base case when using BEV. Currenthydrogen production leads to a GHG reduction of 33% when using FCEV which however cannot be scaled tolarger fleets. Using current electricity in electrolysis will increase GHG emission by 60% compared to the basecase. Assuming 100% renewable electricity for charging and hydrogen production, the reduction from FCEVsrises to 73% and from BEV to 92%. The primary energy requirement for BEV is in all cases lower and forhigher compared to the base case. We conclude that while FCEV have a slightly higher GHG savings potentialwith current hydrogen, BEV are the favored technology for urban freight transport from an economic andecological point of view, considering the increasing shares of renewable energies in the grid mix.

The World Health Organization has developed the Integrated Care of Older People (ICOPE) strategy, a program based on the measurement of intrinsic capacity (IC) as “the composite of all physical and mental attributes on which an individual can draw”. Multicomponent interventions appear to be the more effective approach to enhance IC and to prevent frailty and dependence, being adapted physical activity is the preventive intervention that has shown more evidence in the treatment of frailty and risk of falls. The present study aims to describe the development of a multi-domain group-based intervention addressed to frail older people living in the community aimed to improve and/or maintain intrinsic capacity by means of promoting physical activity, healthy nutrition, and psychological wellbeing in frail older people. We used the GUIDED checklist to describe the development process of AMICOPE (Aptitude Multi-domain group-based intervention to improve and/or maintain IC in frail Older PEople). The intervention was built upon the ICOPE framework and it is described with Template for Intervention Description and Replication (TIDieR) guidelines and it includes dietary advice, cognitive stimulation strategies, medication review, goal setting, and activities to strengthen social support and manage depressive symptoms, as well as strength, balance and flexibility exercise using the Vivifrail program. The study represents the first stage of the UK Medical Research Council framework for developing and evaluating a complex intervention. The next step should be carrying out a feasibility study for the AMICOPE intervention, and in a later stage, assessing the effectiveness in a randomized controlled trial.

Background: To compare the loss of preload in absence of loading and after a fixed number of ideal masticatory cycles in two different connection systems using all-on-four prosthetic model. Methods: Two equal models of an edentulous mandible rehabilitated with all-on-four technique with two types of abutment system (MUA and OT-Bridge) supporting a hybrid prosthesis, were used. Initial torque values of the prosthetic fixing screw, after ten minutes from initial screw tightening and after 400000 masticatory cycles were registered using a mechanical torque gauge. Differences between initial and final torque values were reported for each anchoring system and the two systems were finally compared. Results: No statistically significant differences regarding the loss of preload between MUA and OT-Bridge system were found after 400000 masticatory cycles; however, in MUA system it was found between anterior and posterior implant screws. A significant difference in preload loss was found only for MUA system comparing the initial screw torque to that measured after 10 minutes from the tightening in absence of cyclic loadings. Conclusions: MUA and OT-Bridge are reliable prosthetic anchoring systems able to tolerate repeated masticatory cycles also on distal cantilever in all-on-four rehabilitation model without any significant loss of preload in screw tightening

The construction of optimized biological fuel cells requires a cathode which combines the longevity of a microbial catalyst with the power density of an enzymatic catalyst. Laccase secreting fungi were grown directly on the cathode of a biological fuel cell to facilitate the exchange of inactive enzymes with active enzymes with the goal of extending the lifetime of laccase cathodes. Additionally, a functionally graded coating was developed to increase enzyme loading at the cathode. Directly incorporating the laccase producing fungus at the cathode extends the operational lifetime of laccase cathodes while eliminating the need for frequent replenishment of the electrolyte. Additionally, the hybrid microbial-enzymatic cathode addresses the issue of enzyme inactivation by using the natural ability of fungi to exchange inactive laccases at the cathode with active laccases. Finally, enzyme adsorption was increased through the use of a functionally graded coating containing an optimized ratio of titanium dioxide nanoparticles and single walled carbon nanotubes. The hybrid microbial-enzymatic fuel cell combines the higher power density of enzymatic fuel cells with the longevity of microbial fuel cells and demonstrates the feasibility of a self-regenerating fuel cell in which inactive laccases are continuously exchanged with active laccases.

The study aims to elaborate a neural model and algorithm for optimising hardness and porosity of coatings and thus ensure that they have superior cavitation erosion resistance. Al2O3-13wt.%TiO2 ceramic coatings were deposited onto 316L stainless steel by atmospheric plasma spray (ASP). The coatings were prepared with different values of two spray process parameters: the stand-off distance and torch velocity. Microstructure, porosity and microhardness of the coatings were examined. Cavitation erosion tests were conducted in compliance with the ASTM G32 standard. Artificial neural networks (ANN) were employed to elaborate the model, and the multi-objectives genetic algorithm (MOGA) was used to optimise both properties and cavitation erosion resistance of the coatings. Results were analysed with Matlab software by Neural Network Toolbox and Global Optimization Toolbox. The fusion of artificial intelligence methods (ANN+MOGA) is essential for future selection of thermal spray process parameters, especially for the design of ceramic coatings with specified functional properties. Selection of these parameters is a multicriteria decision problem. The proposed method made it possible to find a Pareto front, i.e. trade-offs between several conflicting objectives – maximising the hardness and cavitation erosion resistance of Al2O3-13%TiO2 coatings and, at the same time, minimizing their porosity.

In recent years, distributed generation technology has developed rapidly. Renewable energy, represented by wind energy and solar energy, has been widely studied and utilized. In order to give full play to the advantages of Distributed Generation (DG) and meet the challenges after power grid access, Active Distribution Network (ADN) is considered as the future development direction of traditional distribution network because of its ability of active management. Nowadays, multi-scenario analysis is widely used in the research of optimal allocation of distributed power supply in active distribution network. Aiming at the problems that may arise when using multi-scenario analysis to plan DG with uncertainties in large-scale scenarios, a scenario reduction method based on improved clustering algorithm is proposed. The validity of the scene reduction method is tested, and the feasibility of the method is verified. At present, there are few studies on the optimal allocation of DG in ADN under fault state. In this paper, comprehensive safety indicators are introduced. Considering the timing characteristics of DG and the influence of active management mode, a bi-level programming model is established, which aims at minimizing the investment of annual life cycle and the removal of active power. The bi-level model is a complex mixed integer non-linear programming model. A hybrid algorithm combining cuckoo search algorithm and primal dual interior point method is used to solve the model. Finally, through the simulation of the IEEE-33 node system, the superiority of the scenario reduction method and the comprehensive security index used in this paper to optimize the configuration of DG in ADN is verified.

Direct laser writing three-dimensional nano-lithography is an established technique for manufacturing functional 3D micro- and nano-objects via non-linear absorption induced polymerization process. In this Chapter an underlying physical mechanisms taking place during nano-confined polymerization reaction, induced by tightly focused ultra-short laser pulses, are reviewed and discussed. The special attention is paid on the effects that directly impact structuring resolution and minimum achievable feature size. Analysis of possible photo-initiation mechanisms as contributing multi-photon absorption and avalanche ionization in pre-polymers under diverse exposure conditions (wavelength, pulse duration) is presented. Feasible structuring of pure (non-photosensitized) and functional nanoparticles doped polymer precursors is justified and benefits of such materials/structures for microoptics, photonics and cell scaffolds are highlighted. The influence of temperature effects (induced by writing process itself or determined by ambient conditions) on polymerization process, observed in different pre-polymers under diverse exposure regimes is outlined. The further adjustment of the structuring resolution is possible via precise control of light polarization and diffusion assisted radical quenching. The work is concluded with a brief outlook on future challenges and perspectives related to refinement of 3D ultra-fast laser lithography fabrication process in the means of application of diverse post-processing methods and research into novel photo-curable materials including inorganic ones.

Neutrosophic cubic set is the hybridization of the concept of neutrosophic set and interval neutrosophic set. Neutrosophic cubic set has the capacity to express the hybrid information of both the interval neutrosophic set and the single valued neutrosophic set simultaneously. As newly defined, little research on the operations and applications of neutrosophic cubic sets appear in the current literature. In the present paper we propose the score, accuracy functions for neutrosophic cubic sets and prove their basic properties. We firstly develop TODIM method to solve multi attribute group decision making in neutrosophic cubic set environment, which we call NC-TODIM. Also, we solve a MAGDM problem using the proposed NC-TODIM method to show the applicability and effectiveness of the developed method. We also conduct sensitivity analysis to show the impact of ranking order of the alternatives for different values of attenuation factor of losses for multi-attribute group decision making problem.

This paper deals with the environmental characterization of a large and densely populated area, with a poor reputation for contamination, considering the contribution of environmental features (air, soil, soil hydraulic and groundwater) and the potential effects on human health. The use of Geographic Information System (GIS) has made possible a georeferenced inventory and, by overlaying environmental information, an operational synthesis of comprehensive environmental conditions. The cumulative effects on environmental features were evaluated, taking into account superposition effects, by means of the spatial multicriteria decision analysis (S-MCDA). The application of the S-MCDA for converging the combination of heterogeneous factors, related to soil, land and water, deeply studied by heterogeneous groups of experts, constitutes the novelty of the paper. The results confirmed an overall higher potential of exposure to contaminants in the environment and higher mortality rates in the study area for some tumours, but hospital admissions for tumours were generally similar to the regional trend. Besides, mortality data may be strictly dependent on the poor socioeconomic conditions, quality of therapy and a lack of welfare in the area relative to the rest of Italy. Finally, as regards the possible relationship between presence of contaminants in the environment and health conditions of the population no definite conclusions can be drawn, although the present study encourages the use of the new proposed methods, that increase the possibilities for studying the combined effect of more environmental factors.

The most common type of head and neck cancer (HNC) is head and neck squamous cell carcinoma (HNSCC). It describes a heterogenous neoplastic disease that arises from the mucosal epithelium of the of the upper respiratory system and the gastrointestinal tract. It is characterized by high morbidity and mortality, being is the eighth most common cancer worldwide, with 931,931 newly diagnosed cases and 467,125 deaths according to the latest Global Cancer Statistics (GLOBOCAN) data. Despite the use of modern low-invasive surgical techniques and application of promising new chemoradiotherapies or combination treatment, the frequency of recurrences and the five-year survival of these patients remains unsatisfactory. The microenvironment of head and neck cancer comprises various cells that regulate neoplastic expansion. It is believed that the mesenchymal stromal cells (MSCs) present in the tumour milieu play a key role in the modulation of tumour initiation, development and progression, in the regulation of cancer treatment response, survival rates, patient outcomes and long-term prognosis; they also influence the resistance to cisplatin-based chemotherapy, the gold standard for advanced HNSCC. MSCs, are multipotent, heterogeneous, mobile cells, which meet specific stemness criteria defined by the International Society for Cellular Therapy (ISCT). Although no MSC-specific markers exist, they can be recognized based on several others, such as CD73, CD90 and CD105, while lacking the presence of CD45, CD34, CD14 or CD11b, CD79α, or CD19 and HLA-DR antigens; they share phenotypic similarity with stromal cells and their capacity to differentiate into other cell types. In the tumour niche, MSC populations are characterized by cell quiescence, self-renewal capacity, low reactive oxygen species production and the acquisition of epithelial-to-mesenchymal transition properties, they may play a key role in the process of acquiring drug resistance, and thus treatment failure. MSCs must also demonstrate plastic adherence in vitro and be able to differentiate into specific mesodermal cell types after stimulation i.e., adipocytes, chondrocytes, and osteoblasts when cultured under well-defined conditions. The present narrative review examines the links between mesenchymal stromal/stem cells and HNC, as well as the different mechanisms involved in the development of resistance to current chemo- and radiotherapies in HNSCC. It provides an overview of the current literature, including key opinion-forming systematic reviews, as well as cross-sectional, longitudinal, prospective and interventional studies based on cell culture models in vitro, animal or in vivo models of HNSCC; it also examines the possibilities of pharmacological targeting of stemness-related chemoresistance in HNSCC. It describes promising new strategies to optimize chemoradiotherapy with the potential to personalize patient treatment approaches, and highlights future therapeutic perspectives in HNC. The data concerning tumour-associated MSCs is arranged according to increasing clinical credibility.

Immune checkpoint receptors play a crucial role in steering tumor progression, prompting a focused investigation into the role of TIM3 in breast cancer. Analysis of TCGA BRCA data unveiled diverse correlations between TIM-3 expression and immune cell infiltration across subtypes. In our in-house cohort studied through IHC, significant changes in TIM3 expression with tumor grades were observed. Higher TIM3 expression correlated with increased disease-free survival in pan breast cancer, marking the first revelation of TIM3's positive role in pan BC prognosis. The study indicates that alluring TIM3 response, rather than suppression, may enhance breast cancer prognosis.

Background: Newer personalized medicine including targeted therapies such as PARP inhibitors and CDK 4/6 inhibitors have shown to improve survival of breast and gynaecological cancer patients. However, efficacy outcomes may be hampered by treatment discontinuation due to targeted therapy-related adverse drug reactions or resistance. Studies suggest that add-on mistletoe (Viscum album L., VA) improves quality of life and ameliorates cytotoxic side effects of standard oncological therapy in cancer patients. The primary objective of this real-world data study was to determine the safety profile of targeted therapy in combination with add-on Helixor® VA therapy in breast and gynecological cancer patients. Methods: The present study is a real-world data study utilizing demographic and treatment data from the accredited national Network Oncology (NO) registry. The study has received ethics approval. The safety profile of targeted with or without Helixor® VA therapy as well as safety - associated variables were evaluated by univariate and adjusted multivariable regression analyses. Results: All stage breast or gynecological cancer patients (n = 242) were on average 54.5±14.2 years old. One hundred and sixty patients (66.1%) were in the control (CTRL, targeted therapy) and 82 patients (33.9%) in the combinational (COMB, targeted plus Helixor® VA therapy) group. The addition of Helixor® VA did not hamper the safety profile (χ2 = 0.107, p-value = 0.99) of targeted therapy. Furthermore, no adverse events and a trend towards an improved targeted therapy adherence were observed in the COMB group. Conclusions: The present study is the first of its kind showing the applicability of Helixor® VA in combination with targeted therapies. The results indicate that add-on Helixor® VA does not negatively alter the safety profile of targeted therapies in breast and gynaecological cancer patients.

This study investigated whether quantitative MRI and histology of the prostate reveals differences between races that can affect diagnosis. Cancer signal enhancement rate (α) on DCE-MRI was significantly higher for African Americans (AA) compared to Caucasian Americans (CA). Signal washout rate (β) was significantly lower in benign tissue in AAs and significantly elevated in cancers in AAs. However, no significant differences were found for ADC and T2. ROC analysis showed that ADC and T2 are slightly less effective in AA compared to CA. DCE significantly improves the differentiation of PCa from benign in AAs (α: 52%, β: 62% more effective in AA compared to CA). Histologic analysis showed cancers have a greater proportion of epithelium and lower lumen in AA compared to CA. This study shows that the different races have different quantitative MRI values and histologic makeup. Quantitative DCE-MRI is highly effective and improves PCa diagnosis in African Americans.

Cutaneous squamous cell carcinoma (cSCC) is the second most common form of skin cancer, with an increasing global incidence. While most cases are successfully treated with surgical excision, a subset can metastasize, leading to significant morbidity and mortality. Current staging systems based on clinical and histopathological features have shown limitations in accurately predicting metastatic risk. This review examines the role of gene expression profiling (GEP), particularly the 40-gene expression profile (40-GEP) test, in improving risk stratification and management of cSCC. We assess the prognostic value of the 40-GEP test, its integration with current staging systems, and its impact on clinical decision-making. Recent studies suggest that incorporating GEP results with traditional staging methods can enhance the identification of high-risk patients, potentially leading to more personalized treatment strategies. The review also explores the challenges of implementing GEP in routine clinical practice, including cost-effectiveness considerations and the need for standardization. Finally, we discuss the implications for future cSCC management and highlight areas for further research. As molecular profiling techniques continue to evolve, GEP represents a promising approach to optimizing care for cSCC patients, aligning with the growing emphasis on personalized medicine in oncology.

Background: Colorectal cancer is a major global health burden, with surgical resection being the standard treatment aimed at curative tumor removal. Oxidative stress plays a crucial role in colorectal cancer progression and prognosis. This study hypothesized that physical removal of colorectal cancer, a primary source of oxidative stress, would reduce blood levels of reactive oxygen metabolite derivatives (d-ROMs), a marker of oxidative stress, and biologic antioxidant potential (BAP) levels, a marker of antioxidant potential. Methods: The study included 123 patients who underwent radical resection for colorectal cancer. d-ROM and BAP levels were measured before and one month after surgery. Results: The clinicopathological analysis showed a correlation between preoperative d-ROM levels and tumor size (p<0.001). The study confirmed a significant reduction in d-ROM levels following tumor resection, indicating reduced systemic oxidative stress. The reduction was significant in stages II and III but not in stage I. The d-ROM ratio before and after tumor resection was significantly higher in cases with positive lymph node metastasis and larger tumor size. BAP levels showed no significant changes post-surgery. Conclusion: These results suggest that d-ROMs could serve as a valuable biomarker for monitoring tumor burden and surgical efficacy in patients with colorectal cancer.

Often, in biology, we are faced with the problem of exploring relevant unknown biological hypotheses in the form of myriads of combinations of factors/genes/proteins that might be affecting the pathway under certain conditions. In colorectal cancer (CRC) cells treated with ETC-1922159, many genes were found up and down regu- lated, individually. A recently developed search engine ranked combinations of Inter- leukin (IL)-X (X, a particular gene/protein) at 2nd order level after drug administration. These rankings reveal which IL-X combinations might be working synergistically in CRC. If found true, oncologists can further test the combination of interest in wet lab and determine the mechanism of functioning between the IL and X. In this research work, we cover combinations of IL with nuclear factor κ B (NFκB), Potassium ion channel sub- family members (KCN), mucin (MUC), TP53, STAT, TNF receptor as- sociated factor (TRAF), STEAP4 metalloreductase, STEAP3 metalloreductase, ATP- binding cassette (ABC) transporters and tumor necrosis factor (TNF).

Often, in biology, we are faced with the problem of exploring relevant unknown biological hypotheses in the form of myriads of combinations of factors/genes/proteins that might be affecting the pathway under certain conditions. In colorectal cancer (CRC) cells treated with ETC-1922159, many genes were found up and down regu- lated, individually. A recently developed search engine ranked combinations of DNA repair gene-X (X, a particular gene/protein) at 2nd order level after drug administration. These rankings reveal which Wnt-X combinations might be working synergistically in CRC. If found true, oncologists can further test the combination of interest in wet lab and determine the mechanism of functioning between the Wnt and X. In this re- search work, we cover combinations of RAD with X-ray repair cross complementing (XRCC) family, 5’-3’ exoribonuclease 2 (XRN2), NFKB repressing factor (NKRF), B cell CLL/lymphoma (BCL) family, exosome component (EXOSC) family, FA comple- mentation group (FANC) family and XRCC with EXOSC.

Estrogen receptor α (ERα) is a nuclear hormone receptor that mediates the biological effects of estrogen and is known to be phosphorylated at multiple sites. Despite several reports highlighting serine-167 (S167) of ERα as a common phosphorylation site for various kinases, there have been contradictory data regarding its relevance in the context of ERα-expressing luminal A breast cancer. In this study, we show that S167 is targeted by the oncogenic PIM family kinases in these cells. Loss of PIM expression or catalytic activity reduces S167 phosphorylation and restricts ERα signaling, while PIM overexpression has the opposite effect. Nonetheless, we found no evidence that PIMs protect breast cancer cells from ERα blockade, as both PIM protein levels and ERα S167 phosphorylation levels were substantially lower in populations of cells that had developed tamoxifen resistance as compared to untreated cells. However, this does not rule out the possibility that PIMs provide protection against ERα-targeting therapies in such breast cancer cells in which they are overexpressed, warranting further investigations.

Control of oxidation/antioxidation homeostasis is important for cellular protective functions, and disruption of the antioxidation balance by exogenous and endogenous ligands can lead to profound pathological consequences of cancerous commitment within cells. Although cancers are sensitive to antioxidation drugs, these drugs are sometimes associated with problems including tumor resistance or dose-limiting toxicity in host animals and patients. These problems are often caused by the imbalance between the levels of oxidative stress induced reactive oxygen species (ROS) and the redox efficacy of antioxidants. Increased ROS levels, because of abnormal function, including metabolic abnormality and signaling aberrations, can promote tumorigenesis and the progression of malignancy, which are generated by genome mutations and activation of pro-oncogene signaling. This hypothesis is supported by various experiments to show that the balance of oxidative stress and redox control is important for cancer therapy. Although many antioxidant drugs exhibit therapeutic potential, there is a heterogeneity of antioxidation functions, including cell growth, cell survival, invasion abilities, and tumor formation, as well as the expression of marker genes including tumor suppressor proteins, cell cycle regulators, nuclear factor erythroid 2-related factor 2, and Jun dimerization protein 2; and their effectiveness in cancer remains unproven. Here, we summarize the rationale for the use of antioxidative drugs in preclinical and clinical antioxidant therapy of cancer, and recent advances in this area using cancer cells and their organoids, including the targeting of ROS homeostasis.

Recent epidemiologic studies have revealed an upward trend in young-onset colorectal cancer (YOCRC) overall, whereas specific data on young-onset colorectal neuroendocrine neoplasms (YONEN) remain limited. This study investigates demographic characteristics and survival trends in YONEN and compares these with those of young-onset colorectal adenocarcinoma (YOADC), the most common histologic subtype of YOCRC. A retrospective analysis was conducted from 2000 to 2019 using the Surveillance, Epidemiology, and End Results (SEER) database. Survival outcomes were assessed using univariate and multivariable Cox proportional models, with demographic differences evaluated via Wilcoxon Rank Sum and Chi-square tests. Out of 61,705 patients aged 20-49 with colorectal cancer, 8% had NEN, and 92% had adenocarcinoma. The YONEN cohort had a higher proportion of Black patients and a lower proportion of White patients than the YOADC cohort (21% vs. 13% and 44% vs. 57%, respectively). NEN was more commonly found in the rectum (79%), and adenocarcinoma was mostly colonic (57%) in origin. YONEN patients had better survival than YOADC patients. Multivariate analysis in YONEN patients revealed that Hispanic patients had better overall survival compared to White patients (HR 0.67, 95% CI 0.47-0.95, p=0.024). Racial disparities should be investigated further to aid in policymaking and targeted interventions.

Pancreatic ductal adenocarcinoma (PDAC) remains one of the most lethal malignancies, characterized by its aggressive progression and dismal prognosis. Advances in epigenetic profiling, specifically DNA methylation analysis, have significantly deepened our understanding of PDAC pathogenesis. This review synthesizes findings from recent genome-wide DNA methylation studies, notably those by Espinet et al. and Wang et al., which have delineated a complex DNA methylation landscape differentiating between normal and cancerous pancreatic tissues, as well as across various stages and molecular subtypes of PDAC. These studies identified specific differentially methylated regions (DMRs) that not only enhance our grasp of the epigenetic drivers of PDAC but also offer potential biomarkers for early diagnosis and prognosis, enabling the customization of therapeutic approaches. The review further explores how DNA methylation profiling could facilitate the development of subtype-tailored therapies, potentially improving treatment outcomes based on precise molecular characterizations. Overall, leveraging DNA methylation alterations as functional biomarkers holds promise for advancing our understanding of disease progression and refining PDAC management strategies, which could lead to improved patient outcomes and a deeper comprehension of the disease’s underlying biological mechanisms.

Pancreatic cancer presents formidable challenges due to rapid progression and resistance to conventional treatments. Oncolytic viruses (OVs) selectively infect cancer cells and cause cancer cells to lyse, releasing molecules that can be identified by the host’s immune system. Moreover, OV can carry immune-stimulatory payloads such as interleukin-12 which when delivered locally can enhance immune system-mediated tumor killing. OV’s are very well tolerated by cancer patients due to their ability to selectively target tumors without affecting surrounding normal tissues. OV’s have recently been combined with other therapies including chemotherapy and immunotherapy to improve clinical outcomes. Several OVs including adenovirus, herpes simplex viruses (HSV), vaccinia virus, parvovirus, reovirus, and measles virus have been evaluated in preclinical and clinical settings for the treatment of pancreatic cancer. We evaluated the safety and tolerability of a replication-competent oncolytic adenoviral vector carrying two suicide genes (thymidine kinase, TK; and cytosine deaminase, CD) and human interleukin-12 (hIL12) in metastatic pancreatic cancer patients in a phase 1 trial. This vector was found to be safe and well-tolerated at the highest doses tested without causing any significant adverse events (SAE). Moreover, long-term follow-up studies indicated an increase in the overall survival (OS) in subjects receiving the highest dose of the OV. Our encouraging long-term survival data provide hope for patients with advanced pancreatic cancers, a disease that has not seen a meaningful increase in OS in the last five decades. In this review article, we highlight several preclinical and clinical studies and discuss future directions for optimizing OV therapy in pancreatic cancer. We envision OV-based gene therapy to be a game changer in the near future with the advent of newer generation OVs that have higher specificity and selectivity combined with personalized treatment plans developed under AI guidance.

The oral microbiome, studied by sampling the saliva or oral rinse, has been long thought to have diagnostic capacity for head and neck cancers (HNC). However, previous reports on the HNC oral microbiome provide inconsistent results. The aim of this study is to consolidate these datasets and determine the oral microbial composition between HNC patients to healthy and premalignant individuals. We analyzed 16 published head and neck cancer (HNC) short-read 16S rRNA sequencing datasets, specifically targeting the V3V4, V4 and V4V5 regions. These datasets included saliva and oral rinse samples from donors with HNC, as well as from healthy and premalignant donors. Differences in diversities and microbial abundance were determined. HNC saliva displayed lower alpha diversity than healthy donors. In contrast, the opposite trend was observed for oral rinse samples. Beta diversity were largely similar across different patient types. Similar oral phyla were detected for all samples, but proportions were largely dependent on sample type (i.e. saliva or oral rinse) and primer set utilised for 16S rRNA sequencing. Neisseria, Leptotrichia and Megasphaera were elevated in healthy saliva, while Mycoplasma was elevated in HNC saliva. Oral rinse and saliva displayed similar enrichment for Fusobacterium, while Veillonella, Alloprevotella, and Campylobacter had conflicting results. The sparse partial least squares discriminant analysis model performed effectively in discriminating HNC from healthy or premalignant patients using V3V4 saliva (AUC = 0.888), and V3V4 oral rinse (AUC = 0.928), while poor discriminative capacity was observed for V4 saliva (AUC = 0.688). In conclusion, our meta-analysis highlighted the limitations of 16S rRNA sequencing, particularly due to variations across study batches, primer sets (i.e. V3V4, V4), and sample types. Hence, caution should be exercised when interpreting 16S rRNA sequencing results across studies, especially when different primer sets and sample types are used.

Many definitions of cancer have been proposed over the years to explain cancer’s origins and pathophysiology, but the disease is too variable to allow any single description to completely encompass all of the myriad traits. A true, unifying theory of cancer must not only reveal how all known carcinogens contribute toward malignancy, but must also elucidate why cancers occur predominately in older patients, why they express so many similar behaviors, as well as account for each cancer’s individual variations. A conceptual reorganization of decades of cancer data may reveal the fundamental process that underlies the malignant transformation of cells, which not only provides a new understanding of the etiology of cancers, but also helps to interpret the subsequent events that occur after transformation, which is of significant clinical interest. The revised concepts of initiation, promotion, and progression suggest that cancer is a failed or incomplete attempt at regeneration that occurs when ordinary cellular events unintentionally coincide over time to force the use of a DNA repair pathway that is normally restricted for use in germ cells.

S6K1 (ribosomal protein S6 kinase beta-1) is a critical serine/threonine kinase involved in the regulation of various cellular processes, including protein synthesis, gene expression, and metabolic homeostasis. The structural complexity of S6K1, with its multiple isoforms and unique kinase domain, allows for diverse functionality across different cellular contexts. In this review, we report the intricate structure of S6K1, highlighting the significance of its kinase domain. Additionally, we explored the tissue-specific expression and subcellular localization of S6K1 isoforms, emphasizing their distinct roles in cellular processes. The regulation of S6K1 extends beyond transcriptional control, with post-translational modifications such as phosphorylation and acetylation playing crucial roles in its activity and stability. The physiological implications of S6K1 are vast, influencing processes from cell growth and protein synthesis to immune responses and muscle hypertrophy. However, dysregulation of S6K1 is implicated in numerous pathological conditions, including cancer Studies reveal that altered S6K1 activity, particularly in its phosphorylation state, can lead to reduced neuronal viability, contributing to the progression of diseases such as Parkinson's. This manuscript synthesizes current knowledge on S6K1, offering insights into its multifaceted roles and highlighting its potential as a therapeutic target in various disease contexts.

Triple-negative breast cancer (TNBC) lacks the expression of estrogen receptors, human epidermal growth factor receptor 2, and progesterone receptors (PR). TNBC has the poorest prognosis among breast cancer subtypes and is more likely to respond to immunotherapy due to its higher expression of PD-L1 and a greater percentage of tumor-infiltrating lymphocytes. Immunotherapy has revolutionized TNBC treatment, especially with the FDA's approval of pembrolizumab (Keytruda) combined with chemotherapy for advanced cases, opening new avenues for treating this deadly disease. Although, immunotherapy can significantly improve patient outcomes in a subset of patients, achieving the desired response rate for all remains an unmet clinical goal. Strategies that improve responses to immune checkpoint blockade, including combining immunotherapy with chemotherapy, molecularly targeted therapy, or radiotherapy may improve response rates and clinical outcomes.  In this review, we provide a short background on TNBC and immunotherapy and explore the different types of immunotherapy strategies that are currently being evaluated in TNBC. Additionally, we review why combination strategies may be beneficial, provide an overview of the combination strategies, and discuss the novel immunotherapeutic opportunities that may be approved in the near future for TNBC.

99mTc is a well-known radionuclide widely used and readily available for medical imaging. Despite this, the 99mTc isotope is rarely utilized for tumour imaging due to the lack of agents that can selectively deliver it to tumours. However, the use of immunologically compatible recombinant proteins, which combine metal-binding sites and tumour-specific ligands, shows promise for utilizing 99mTc in the early detection of tumours. To illustrate this, a protein called E1b, containing a metal binding center with ELP repeats, tumour-specific ligands recognizing integrin αvβ3 and nucleolin, as well as a short Cys-rich sequence, was artificially designed. This protein was produced in E. coli and purified to homogeneity using metal-chelate chromatography. In experiments, C57Bl/6 and Balb/C mice with subcutaneously grafted lung carcinoma (LLC) or mammary gland adenocarcinoma (Ca755, EMT6, or 4T1) were used to test 99mTc-E1b selectivity and the kinetics of isotope retention. The mice were intravenously injected with approximately 80 MBq of 99mTc in complex with E1b, which had been freshly purified using gel-chromatography. The biodistribution of the labeled protein was then studied using the SPECT/CT imaging method within 24 h. The ratio of radionuclide distribution in the tumour versus the adjacent normal tissue (T/N) steadily increased over the 24-h period, reaching 15.7±4.2 for EMT6, 16.5±3.8 for Ca755, 6.7±4.2 for LLC, and 7.5±3.1 for 4T1.

Familial pancreatic cancer (FPC) represents a significant yet underexplored area in pancreatic cancer research. Basic research efforts are notably limited, and when present, they are predominantly centered on BRCA1 and BRCA2 mutations due to the scarcity of other genetic variants associated with FPC, leading to a limited understanding of the broader genetic landscape of FPC. This review examines the current state of FPC research, focusing on the molecular mechanisms driving pancreatic ductal adenocarcinoma (PDAC) progression. It highlights the role of homologous recombination (HR) and its therapeutic exploitation via synthetic lethality with PARP inhibitors in BRCA1/2-deficient tumors. The review discusses various pre-clinical models of FPC, including conventional two-dimensional (2D) cell lines, patient-derived organoids (PDOs), patient-derived xenografts (PDXs), and genetically engineered mouse models (GEMMs) as well as new advancements in FPC research.

Locally advanced rectal cancer requires multimodal treatment. Radiotherapy is being explored for intensification to improve rates of pathological complete responses (ypCR-rates) that correlates with better outcomes. This study reports a comparison between standard versus escalated dose in preoperative scenario. YpCR-rates, toxicity, postoperative complications, disease-free and overall survival at 5 years have been described. From 2012 to 2019, 99 patients were analyzed retrospectively: standard arm (mean 47.5Gy) vs. dose-escalated arm (mean 54.3Gy). All patients were treated with 3DRT in 25 fractions, concomitantly capecitabine and surgery performed according to total mesorectal excision principles in both arms. YpCR was reported by “College of American Pathologist grades”; gastrointestinal (GI) and genitourinary (GU) toxicity using the “Common Terminology Criteria for Adverse Events” (CTCAE 4.0). YpCR-rates were higher in the dose-escalated group (25% vs. 10.64%; p = 0.07) with a lower rate of non-treatment response (61.36% vs. 38.64%; p = 0.11). No statistical differences between arms were found in terms of oncological outcomes, all postoperative complications (p = 0.15), second surgeries (p = 0.62), or deaths (p = 0.62). CTCAE acute-GI and GU toxicity were grade I or II in both arms. Our study shows that the dose-escalated scheme is safer and obtains higher ypCR-rates.

Patients with inflammatory bowel diseases (IBD), including both ulcerative colitis (UC) and Crohn's disease (CD), are at a higher risk of developing colorectal cancer (CRC). However, advancements in endoscopic imaging techniques, integrated surveillance programs, and improved medical therapies have led to a decrease in the incidence of CRC among IBD patients. Currently, the management of patients with IBD who have a history of or ongoing active malignancy is an unmet need. This involves balancing the risk of cancer recurrence/progression with the potential exacerbation of IBD if the medications are discontinued. The objective of this review is to provide an updated summary of the epidemiology, causes, risk factors, and surveillance approaches for CRC in individuals with IBD, and to offer practical guidance on managing IBD patients with history of previous or active cancer.

Background: Cancer therapies predispose survivors to a high symptom burden. This study utilized mobile health (mHealth) technology to assess the feasibility of collecting daily symptoms from adult survivors of childhood cancer and evaluate symptom fluctuation and associations with future health-related quality-of-life (HRQOL). Methods: A prospective study using an mHealth platform to distribute a 20-item cancer-related symptom survey (5 consecutive days each month) and an HRQOL survey (the day after symptom survey) over 3 consecutive months to participants from the Childhood Cancer Survivor Study. PROMIS-29 Profile and Neuro-QOL assessed HRQOL. Daily symptom burden was calculated by summing the severity (mild, moderate, or severe) of 20 symptoms. Univariate linear mixed-effects models analyzed total, person-to-person, day-to-day, and month-to-month variability for the burden of 20 individual symptoms. Multivariable linear regression analyzed the association between daily symptom burden in the first month and HRQOL in the third month, adjusting covariates. Results: Out of the 60 survivors invited, 41 participated in this study (68% enrollment rate); 83% reported their symptoms ≥3 times and 95% reported HRQOL, both in each week across 3 months. Variability of daily symptom burden differed from person-to-person (74%), day-to-day (18%), and month-to-month (8%). Higher first-month symptom burden was associated with poorer HRQOL related to anxiety (regression coefficient: 6.56; 95%CI: 4.10-9.02), depression (6.32; 95%CI: 3.18-9.47), fatigue (7.93; 95%CI: 5.11-10.80), sleep (6.07; 95%CI: 3.43-8.70), pain (5.16; 95%CI: 2.11-8.22), and cognitive function (-6.89; 95%CI: -10.00 to -3.79) in the third month. Conclusion: Daily assessment reveals fluctuations in symptomology, and higher symptom burden was associated with poorer HRQOL in the future. Utilizing mHealth technology for daily symptom assessment improves our understanding of symptom dynamics and sources of variability.

Medicinal plants produce various bioactive molecules with potential anticancer properties with favorable safety profiles. We investigated the comprehensive composition of Vernonia amygdalina leaf extract and its cytotoxic effects via apoptosis in HeLa cells. The metabolomics approach was conducted to gather the metabolite profile of the extract. Proteomics was performed to understand the comprehensive mechanistic pathways of action. The apoptosis was visualized by cellular staining and the apoptotic proteins were evaluated. V. amygdalina leaf extract exhibited dose-dependent cytotoxic effects on both HeLa and Vero cells after 24 h of exposure, however, a higher concentration was required for Vero cells cytotoxicity. The metabolomic profile indicated that majority of metabolites were alkaloids, phenolic compounds, and steroids. The cytotoxic pathways involved the response to stress and cell death which was similar to doxorubicin. The upstream regulatory proteins, PTEN and XBP1, were significantly altered supporting the regulation of apoptosis and cell death. The levels of apoptotic proteins, JNK, p53, and caspase-9 were significantly increased. These provided strong evidence that V. amygdalina leaf extract related to the induction of apoptosis and highlighted its potential for the development of chemotherapy.

Caudal type homeobox transcription factor 2 (CDX2) is a gastrointestinal cancer biomarker that regulates epithelial development and differentiation. Absence or low levels of CDX2 have been associated with poor prognosis and proposed as a chemotherapy response predictor. Tumour tissue of 668 patients with stage I-IV colorectal cancer were stained for CDX2 and stratified into two subgroups according to expression levels. Statistical tests evaluated CDX2 relationship with survival and chemotherapy response. Of 646 samples successfully stained, 51 (7.9%) had low and 595 (92.1%) had high CDX2 levels. Low CDX2 staining was associated with poor differentiation, presence of lymphovascular or perineural invasion, and more common in colon and right sided tumours. Overall survival (p<0.001) and disease-free survival (p=0.009) was lower in low CDX2 expressing patients. Multivariable analysis validated CDX2 as an independent poor prognostic factor after excluding confounding variables. There was no statistically significant improvement in survival with adjuvant chemotherapy in stage II colon cancer (p=0.11). In the rectal cohort, there was no relationship between CDX2 levels and therapy response. While confirming the prognostic utility of CDX2 in colorectal cancer, our study highlights larger studies are required to confirm utility as a predictive chemotherapy biomarker, especially in left sided and rectal cancers.

New strategies for enhancing drug delivery to the blood–brain barrier (BBB) represents a major challenge in treating cerebral diseases. Nano-emulsion based nanocarriers represent an ideal candidate to improve drug delivery thanks to their versatility in functionalization and cargo protection. In this work, a paclitaxel loaded nano-emulsion has been firstly functionalized and stabilized with two layers constituted of chitosan and hyaluronic acid, and, secondly, the latter has been conjugated to the CRT peptide. CRT is a bioactive peptide that selectively recognizes bEnd.3 cells, model of the BBB, thanks to its interactions with transferrin (Tf) and its receptor (TfR). Cytotoxic results showed a higher uptake of CRT functionalized nano-emulsion 41.5 % more than the negative control, demonstrating the ability of this novel tool to be accumulated on the brain endothelium tissue. Thanks to these results, our approach can be fully generalizable to the design of multifunctional nanocarriers for delivery of therapeutic agents to the central nervous systems.

Neoadjuvant therapy (NAT) for early-stage pancreatic ductal adenocarcinoma (PDA) has recently gained prominence. We investigated the clinical significance of mucin 5 AC (MUC5AC), which exists in two major glycoforms, a less-glycosylated immature isoform (IM) and a heavi-ly-glycosylated mature isoform (MM), as a biomarker in resected PDA. Immunohistochemistry was performed on 100 resected PDAs to evaluate the expression of IM and MM isoforms of MUC5AC using respective monoclonal antibodies CLH2 (NBP2-44455) and 45M1 (ab3649). MUC5AC localization (cytoplasmic, apical, and extra-cellular, EC) was determined, and H-scores were calculated. Univariate and multivariate (MVA) Cox regression models were used to estimate progression-free survival (PFS) and overall survival (OS). Of 100 resected PDA patients, 43 received NAT, and 57 were treatment-naïve with upfront surgery (UpS). In the study population (N=100), IM expression (objective response vs. no response vs. UpS = H-scores 104 vs. 152 vs. 163, p=0.01) and MM-MUC5AC detection rates (56% vs. 63% vs. 82%, p=0.02) were significantly different. In the NAT-group, MM-MUC5AC-negative patients had significantly better PFS on MVA (Hazard Ratio, 0.2, 95 % CI: 0.059-0.766, p = 0.01). Similar results were noted in a FOLFIRINOX sub-group (N=36). We established an association of MUC5AC expression with treatment response and outcomes.

Deep inhalation breath hold (DIBH) has become a valuable technique in left breast cancer radiotherapy, offering the possibility to reduce radiation exposure to organs at risk (OARs) and minimize the risk of cardiac complications. The treatment method involves patients stopping breathing during irradiation to temporarily distance the heart from the radiation field, reducing potential cardiac and other complications. Research shows that DIBH reduces the radiation dose to the heart and lungs. However, the effectiveness of DIBH is determined by a variety of factors, including the patient's training, cooperation, anatomical features, age and choice of radiotherapy technique. Additionally, cardiovascular risk factors: diabetes, smoking, hypertension can affect the effectiveness and potential complications of DIBH. Moreover, lack of consent, fear, anxiety, depression and comorbid psychiatric disorders disqualify some patients from the DIBH treatment method. Careful patient selection, comprehensive training and optimization of treatment parameters are essential to maximize the benefits of DIBH while minimizing potential side effects. DIBH enhancement techniques, such as IMRT or VMAT, also have an important role to play. The purpose of this review article is to summarize the factors affecting the efficacy and side effects of DIBH in radiation therapy for left breast cancer, with the aim of optimizing its clinical application while minimizing side effects.

Microstructured surfaces are renowned for their unique properties, such as waterproofing and low adhesion, making them highly applicable in the biomedical field. These surfaces play a crucial role in influencing cell response by mimicking the native microenvironment of biological tissues. In this study, we engineered a series of biomimetic micropatterned surfaces using polydimethylsiloxane (PDMS) to explore their effects on primary breast cancer cell lines, contrasting these effects with those observed on conventional flat surfaces. The surface topography was varied to direct cells’ attachment, growth, and morphology. Our findings elucidate that surface-free energy is not merely a background factor but plays a decisive role in cell dynamics, strongly correlating with the spreading behaviour of breast cancer cells. Notably, on micropillar surfaces with high surface-free energy, an increase in the population of cancer cells was observed. Conversely, surfaces characterised by lower surface-free energies noted a reduction in cell viability. Moreover, the structural parameters, such as the gaps and diameters of the pillars, were found to critically influence cellular dispersion and adherence, underscoring the importance of the microstructures’ topography in biomedical applications. These insights pave the way for designing advanced microstructured surfaces tailored to specific cellular responses, opening new avenues for targeted cancer therapies and tissue engineering.

Gc protein-derived Macrophage Activating Factor (GcMAF), a powerful immunostimulant endowed with anti-cancer and anti-angiogenetic activities, offers significant advantages when combined with radiation therapy. A stronger immune response improves the effectiveness of radiation therapy by allowing the body to better eliminate residual cancer cells after treatment. In addition, by boosting the immune system, GcMAF mitigates some of the immunosuppressive side effects of radiation therapy, leading to faster recovery. In order to fully exploit the potential of GcMAF in cancer therapy, knowledge of the molecular interactions with its receptor is essential. This study proposes the first extracellular domain (residues 1-34) of the CCR1 protein as the GcMAF receptor. The CCR1 gene, expressed in monocytes and 168 other cell types or tissues, encodes this transmembrane protein. Electrostatic and hydrophobic interactions, along with hydrogen bonds mediate the molecular interactions between the TPT^420-GalNAcELAK (or TPK⁴²⁰ELAK) sequences of GcMAF (or Gc2 protein variant) and the TTEDYDTTT sequence of its receptor.

Hydroalcoholic extracts from Malbec and Torrontés wine pomace (Vitis vinifera L.) originating from the high-altitude vineyards of Argentina's Calchaquí Valleys were characterized. Total phenolics, hydroxycinnamic acids, orthodiphenols, anthocyanins, non-flavonoid phenolics, total flavonoids, flavones/flavonols, flavanones/dihydroflavonols, and tannins were quanti-fied through spectrophotometric methods, with Malbec extract exhibiting higher concentra-tions in most of phytochemical groups when compared to Torrontés. HPLC-DAD identified more than 30 phenolic compounds in both extracts. Malbec displayed superior antiradical ac-tivity (ABTS cation, nitric oxide, and superoxide anion radicals), reduction power (iron, copper and phosphomolybdenum), hypochlorite scavenging, and iron chelating ability, compara-tively to Torrontés. The cytotoxicity assessments revealed that Torrontés affected the viability of HT29-MTX and Caco-2 colon cancer cells by 70% and 50%, respectively, at the highest tested concentration (1 mg/mL). At the same time, both extracts did not demonstrate acute toxicity in Artemia salina or in red blood cell assays at 500 µg/mL. Both extracts inhibited the lipoxygen-ase enzyme, with Malbec also reducing the tyrosinase activity and neither inhibited the xan-thine oxidase. The substantial phenolic content and diverse biological activities in Calchaquí Valleys' pomaces underline their potentialities to be valorized for pharmaceutical, cosmetic, and food industries.

Colorectal cancer is one of the most common causes of cancer mortality worldwide, and innovative drugs for the treatment of colorectal cancer are continually being revealed. 5-Fluorouracil (5-FU) is a common clinical chemotherapeutic drug. Acquired resistance to 5-FU is a clinical challenge in colorectal cancer. Parecoxib is a selective COX-2-specific inhibitor, which has been demonstrated to inhibit metastasis in colorectal cancers in our previous study. This study aimed to investigate the synergistic antimetastatic activities of parecoxib to 5-FU in human colorectal cancer cells and determine the underlying mechanism. parecoxib and 5-FU synergistically suppressed metastasis in colorectal cancer cells. Treatment with the parecoxib /5-FU combination induced an increase in E-cadherin and decrease in β-catenin. The parecoxib/5-FU combination could inhibit MMP-9 and MMP-2 expression and MMP-9 activity, and the NF-κB pathway might be suppressed as well. Mechanistic analysis denoted that the parecoxib/5-FU combination hindered the essential molecules of the PI3K/Akt route to obstruct metastatic colorectal cancer. Furthermore, the parecoxib/5-FU combination could inhibit reactive oxygen species. Our work showed the antimetastatic capacity of the parecoxib/5-FU combination for colorectal cancers via targeting the PI3K/Akt /NF-κB pathway.

The efficacy and cost-effectivness of Multigene Panel Next-Generation Sequencing (NGS) in directing patients towards genomically matched therapies remains uncertain. This study investigated metastatic colorectal cancer (mCRC) patients who underwent NGS analysis on formalin-fixed paraffin-embedded tumor samples. Data from 179 patients were analyzed, revealing no mutations in 39 patients (21.8%), one mutation in 83 patients (46.4%), and two or more mutations in 57 patients (31.8%). KRAS mutations were found in 87 patients (48.6%), including KRAS G12C mutations in 5 patients (2.8%), PIK3CA mutations in 40 patients (22.4%), BRAF mutations in 26 patients (14.5%). Less common mutations were identified: ERBB2 in 5 patients (2.8%) and SMO in 4 patients (2.2%). Additionally, MAP2K1, CTNNB1, and MYC were mutated in 3 patients (2.4%). Two mutations (1.1%) were observed in ERBB3, RAF1, MTOR, JAK1, and FGFR2. No significant survival differences were observed based on mutation numbers. 40% of patients had druggable molecular alterations, but only 1.1% received genomically guided treatment, suggesting limited application in standard practice. Despite this, expanded gene panel testing can identify actionable mutations, aiding personalized treatment strategies in metastatic CRC, although current eligibility for biomarker-guided trials remains limited.

In bacteria, enzymes usually comprise of enzymatic domains only. In eukaryotes/mammals, and here particularly in context of signal transduction, proteins with enzymatic functions contain additional modules promoting interactions with cooperating signaling proteins. Often such protein-protein interaction domains, such as SH2- and SH3-domains, help to localize the enzymatic function (e.g. kinase, phosphatase) to another protein, cellular compartment, or membrane nanodomain. In such cases, the interaction domain(s) serve(s) the enzymatic function. However, there are molecular situations in which an interaction domain fulfills its task completely independent of the protein´s enzymatic function and in this review, we call such function the adapter function of an enzyme. Though many stories can be told, we will concentrate on several proteins playing crucial roles in cells of the immune system, such as BTK, PI3K, and SHIP1, as well as in cancer cells, such as proteins of the RAS/ERK MAPK pathway. We will also discuss how these adaptor functions of enzymes determine or even undermine the efficacy of targeted therapy compounds, such as ATP-competitive kinase inhibitors, thereby highlighting the need to develop pharmacological approaches, such as PROTACs, that eliminate the entire protein. We also review how genetic kock-out and knock-in approaches can be leveraged to identify adaptor functions of signaling proteins.

(1) Background: The lateral arm flap has been the very useful choice in the reconstruction of small- to medium-sized defects like hand, extremity, oral head and neck area reconstructions. Its versatile characteristics and surgical feasibility allow this flap to be widely applied, but the reconstructive potential in facial subunit after tumor ablative procedures has never been reported. In this study, we aimed to utilize the advantages of the flap to treat facial temple subunit defect reconstruction. (2) Methods: Between 2020 and 2023, 12 patients underwent temple reconstruction with lateral arm free flaps after malignant tumor wide excision. There were 7 women and 5 men, and the mean patient age was 60.6 years old. Among the patients with cancer, 6 had squamous cell carcinoma, 5 had basal cell carcinoma and 1 had myxofibrosarcoma. All the flaps were elevated under general anesthesia. Aloprostadil(PGE1, Eglandin®) were administered postoperatively. (3) Results: All the flap types were fasciocutaneous type with varied sizes from 3 × 4 to 5 × 7 cm (Average size of flap 22.7cm2) were utilized. The average pedicle length was 6.1cm. The versatility of the lateral arm flap enabled successful coverage of all cases with no specific complications. Good functional outcome and range of motion in the recipient arm were obtained after surgery. (4) Conclusion: The authors successfully verified the advantages of lateral arm flaps in the treatment of medium sized facial subunt temple defect reconstruction.

Wilms tumor (WT), the most prevalent type of renal cancer in children, exhibits overall survival rates exceeding 90%. However, chemotherapy resistance, which occurs in approximately 10% of WT cases, is a major challenge for the treatment of WT, particularly for advanced-stage patients. In this study, we aimed to discover potential mutation markers and drug targets associated with chemotherapy resistance in advanced stage WT. We performed exome sequencing to detect somatic mutations and molecular targets in 43 WT samples, comprising 26 advanced stage WTs, of which 7 cases are chemotherapy-resistant. Our analysis revealed four genes (ALPK2, C16orf96, PRKDC, and SVIL) that correlated with chemotherapy resistance and reduced disease-free survival in ad-vanced-stage WT. Additionally, we identified driver mutations in 55 genes within the chemo-therapy-resistant group, including 14 druggable cancer driver genes. Based on the mutation profile of the resistant WT samples, we propose potential therapeutic strategies involving platinum-based agents, PARP inhibitors, and antibiotic/antineoplastic agents. Our findings provide insights into the genetic landscape of WT and offer potential avenues for targeted treatment, particularly for patients with chemotherapy resistance.

(1) Background: Breast cancer is the leading malignancy worldwide and in Ghana it has a poor overall survival. However, approximately 50% of cases are early stage disease and with advances in breast cancer treatment and improvement in survival, quality of life (QOL) becomes as im-portant as treatment of the disease. (2) Methodology: This was a cross-sectional study of survivors who had breast conserving surgery (BCS), mastectomy only (M) and mastectomy with breast re-construction (BRS) from 2016 to 2020 at a tertiary hospital in Ghana, comparatively assessing their QOL using EORTC QLQ C-30 and EORTC QLQ BR-23. (3) Results: The study participants had an overall Global Health Status (GHS) median score of 83.3 [IQR: 66.7-91.7] with no significant differences between the surgery types. The BRS group had a statistically significant lower median scores for the Functional scale (82.8 and 51.0) and the highest scores for the Symptomatic scale (15.7 and 16.5). Body image was significantly lowest for the BRS group 83.3 [68.8-91.7] and highest 100 [91.7-100] for the BCS group (p < 0.001). (4) Conclusion: There is a need to develop support systems tailored at improving the QOL of breast cancer survivors taking into consideration the type of surgery performed.

Results from the phase III Keynote-024 clinical trial have established Pembrolizumab monotherapy as the first-line standard of care for patients with metastatic NSCLC who have PD-L1 expression ≥ 50%, EGFR and ALK wild-type. However, given the differences between patients treated in routine clinical practice and within a clinical trial, real-world data are needed to confirm the treatment benefit in standard practice. Given the lack of data on large cohorts of patients with long follow-up, we designed a retrospective observational study of patients with NSCLC who were treated with Pembrolizumab, starting from its reimbursement eligibility until December 2020. The primary endpoints were to assess PFS and OS using the Kaplan-Meier method, treatment response and safety. We followed 880 patients (median follow-up: 35.1 months) until February 2022. Median PFS and OS were 8.6 months (95% CI: 7.6-10.0) and 25.5 months (95% CI: 21.8-31.6), respectively. We also found that ECOG PS, PD-L1 expression and smoking habit were prognostic factors for PFS, while age, sex, ECOG PS, smoking habit and histology had an impact on OS. Multivariable analysis confirms prognostic role of PD-L1 for PFS and ECOG for both PFS and OS. 39.9% of patients reported an adverse event, but only 6.3% of patients discontinued therapy due to toxicity. Our results suggest a long-term benefit of Pembrolizumab in the first-line setting as well as a safety profile consistent with the results of Keynote-042. Many collected variables appear to influence clinical outcome, but results from these exploratory unadjusted analyses should be interpreted with caution.

In breast cancer, epithelial-mesenchymal transition (EMT) is positively associated with programmed death ligand 1 (PD-L1) expression and immune escape, and TWIST1 induces EMT and cancer metastasis. However, how TWIST1 regulates PD-L1 and immune evasion is unknown. This study analyzed TWIST1 and PD-L1 expression in breast cancers, investigated the mechanism for TWIST1 to regulate PD-L1 transcription, and assessed the effects of TWIST1 and PD-L1 in cancer cells on the cytotoxicity of CD8+ effector T cells. Interestingly, TWIST1 expression is associated with high-level PD-L1 in triple negative breast cancers (TNBCs). Overexpression and knockdown of TWIST1 robustly upregulates and downregulate PD-L1 expression, respectively. TWIST1 binds to the PD-L1 promoter and recruits the TIP60 acetyltransferase complex in a BRD8-dependent manner to promote PD-L1 expression, which drives immune escape of breast cancer cells by accelerating the exhaustion of CD8+ T cells. Accordingly, knockdown of TWIST1 or BRD8 or blockade of PD-L1 with a PD-L1 antibody significantly enhances CD8+ T cells to inhibit breast cancer cell growth. These results demonstrate that TWIST1 directly induces PD-L1 expression in breast cancer cells to drive immune evasion. Targeting TWIST1, BRD8 or PD-L1 in TNBC should facilitate CD8+ T cell-mediated immune therapy. TWIST1 may also serve as a biomarker for anti-PD-L1 immunotherapy.

We have been encouraging practicing gynecologists to adopt molecular diagnostics tests, PCR, and cancer biomarkers, as an alternative enabled by these platforms to traditional Papanicolaou and colposcopy tests, respectively. An aliquot of liquid-based cytology was used for the molecular test [high-risk HPV types, (HR HPV)], another for the PAP test and still one more for the p16/Ki67 dual stain cytology. A total of 4,499 laboratory samples were evaluated, and we found that 25.1% of low-grade samples and 47.9% of high-grade samples after PAP testing had a negative HR HPV-PCR result. In those cases, reported as Pap-negative, 22.1% got a positive HR HPV-PCR result. Dual staining with the p16/Ki67 biomarkers in samples was positive for HR HPV, and 31.7% were also positive for these markers. Of the PCR results positive for any of these high-risk HPV subtypes, n 68.3% we did not to find evidence for the presence of cancerous cells, highlighting the importance of performing dual staining with p16/Ki67 after PCR, to avoid unnecessary colposcopies. Encountered challenges are a deep-rooted social reluctance in Mexico to abandon traditional Pap smears and the opinion of many specialists, we still believe that colposcopy continues to be a preferred procedure over dual staining protocol.

Background Homologous recombination deficiency (HRD) evolved into a major diagnostic marker in high grade ovarian cancer (HGOC) predicting the response to poly (Adenosine diphosphate-ribose) polymerase inhibitors (PARPi) and also platinum-based therapy. In addition to HRD, the type of peritoneal tumor spread influences treatment response and patient survival; miliary type tumor spread has poorer predicted outcome than non-miliary type tumor spread. Methods Known methods for HRD assessment were adapted for our technical requirements and the Predictive-value Integrated Genomic Instability Score (PIGIS) for HRD assessment evolved as an outcome. PIGIS was validated in HGOC samples from 122 patients. We used PIGIS to analyze whether the type of tumor spread correlated with HRD status and whether this had an impact on survival. Results We demonstrated that PIGIS can discriminate HRD positive from HRD negative samples. Tumors with miliary tumor spread are HRD negative and have a very bad prognosis with a progression free survival (PFS) of 15.6 months and an overall survival (OS) of 3.9 years. However, HRD negative non-miliary spreading tumors in our cohort had a much better prognosis (PFS 35.4 months, OS 8.9 years), similar to HRD positive tumors (PFS 34.7 months, OS 8.9 years). Conclusions Our results indicate that in a predominantly PARPi naïve cohort the type of tumor spread might be a better predictor of response to platinum sensitivity than HRD. It remains to be determined, whether this also applies for sensitivity to PARPi.

Alteration in heparan sulfate (HS) biosynthesis has been described to impact a range of pivotal processes involved in cancer progression. HS 3-O-sulfotransferase 3B1 (HS3ST3B1) catalyzes the reaction of 3-O-sulfation within HS chains. Over the past few years, a growing number of studies has reported a tumor-promoting effect of this HS-modifying enzyme in various cancers. Consistent with these studies, we previously reported that HS3ST3B1 overexpression increased survival and resistance to apoptosis in MDA-MB-231 breast cancer (BrCa) cells. In the present study, we further investigated the biological and clinical significance of HS3ST3B1 expression in BrCa. Interrogation of public databases revealed that high expression levels of HS3STB1 are associated with invasive and mesenchymal-like phenotype in BrCa cells and predict poor clinical outcome in BrCA patients with chemotherapy. In vitro, HS3ST3B1 overexpression increased the invasive properties of MDA-MB-231 cells and enhanced chemo-resistance to conventional anticancer drugs. Mechanistically, we found that the advantage given by HS3ST3B1 was linked to the expression and activation of PDGF-Rβ. Silencing the expression of this receptor reversed the effects driven by HS3ST3B1 overexpression. Altogether, our results suggest that HS3ST3B1 may play an important role in the progression of aggressive BrCa and offer a potentially druggable target for therapeutic application.

DNA Topoisomerase IIa (Top2A) is a nuclear enzyme that is a cancer drug target, and there is interest in identifying novel sites on the enzyme to inhibit cancer cells more selectively and to reduce off-target toxicity. The C-terminal domain (CTD) is one potential target, but it is an intrinsically disordered domain, which prevents structural analysis. Therefore, we set out to analyze the sequence of Top2A from 105 species using bioinformatic analysis including the PSICalc algorithm, entropy analysis, and other approaches. Our results demonstrate that large (10th-order) interdependent clusters are found including non-proximal positions across the major domains of Top2A. Further, CTD-specific clusters of 3rd, 4th, and 5th-order were identified that included positions that had been previously analyzed via mutation and biochemical assays. Some of these clusters coincided with positions that when mutated either increased or decreased relaxation activity. Finally, sites of low entropy (i.e., high information content) were identified and mapped as key positions in the CTD. Included in the low entropy sites are phosphorylation sites and charged positions. Together, these results help to build a clearer picture of the critical positions in the CTD and provide potential sites/regions for further analysis.

Background: Penile squamous cell carcinoma (PSCC) is classified into two prognostically distinct types: human papillomavirus (HPV)-associated and HPV-independent. Conversely, the impact of p53 status on prognosis remains controversial. We correlated HPV and p53 status with prognosis in a large series of PSCC patients. p53 was analysed according to a recently described immunohistochemical (IHC) pattern-based framework that includes two normal (scattered, mid-epithelial) and four abnormal patterns (diffuse, basal overexpression, cytoplasmic and null) and closely correlates with TP53 mutational status. Methods: A total of 122 patients with surgically treated PSCC in three hospitals in Barcelona, Spain, were included. Based on HPV in situ hybridization and p16 and p53 IHC expression, the tumors were classified into three molecular types: HPV-associated, HPV-independent/p53 normal, and HPV-independent/p53 abnormal. All patients were followed for at least 22 months (median 56.9 months), and disease-specific survival (DSS) was analysed. Results: Thirty-six tumors (29%) were HPV-associated, 35 (29%) were HPV-independent/p53 normal, and 51 (42%) were HPV-independent/p53 abnormal. Disease-related deaths were observed in 3/36 (8%), 0/35 (0%) and 14/51 (27%) of the patients, respectively (p&lt;0.001). A total of 7/14 deaths in the latter group were patients with tumors showing p53 patterns not recognized in the classical p53 IHC interpretation (basal, null, cytoplasmic). According to our multivariate analysis, HPV-independent/p53 abnormal tumors and advanced stage were associated with impaired DSS (hazard ratio=23.4, 95% confidence interval [CI]= 2.7-3095.3; p=0.001 and 16.3, 95% CI=1.8-2151.5; p=0.008, respectively). CONCLUSION: Compared with patients with HPV-associated and HPV-independent/p53-normal PSCC, patients with HPV-independent/p53 abnormal PSCC have worse clinical outcomes. p53 IHC results define two prognostic categories in HPV-independent PSCC: HPV-independent/p53-normal tumors as low-risk tumors, whereas HPV-independent/p53-abnormal tumors as aggressive neoplasms.

The application of artificial intelligence to point-of-care testing (POCT) disease detection has become a hot research field, in which breath detection which detects the patient's exhaled VOCs combined with sensor arrays of Convolutional Neural Network (CNN) algorithms as a new lung cancer detection is attracting more researchers' attention. However, due to low accuracy, high complexity computation and large number of parameters make the CNN algorithms difficult transplant to the embedded system of POCT devices. A lightweight neural network (LTNet) in this work is proposed to deal with this problem, and meanwhile, achieve high-precision classification of acetone and ethanol gases, which are respiratory markers for lung cancer patients. Compared to currently popular lightweight CNN models such as EfficientNet, LTNet has fewer parameters (32K) and its training weight size is only 0.155 MB. LTNet achieved an overall classification accuracy of 99.06% and 99.14% in the own mixed gas dataset and the University of California (UCI) dataset, which are both higher than that of the five existing models’, and it also offers the shortest training (844.38s and 584.67s) and inference time (23s and 14s) in the same validation set. Compared to the existing CNN models, LTNet is more suitable for resource-limited POCT devices.

Research indicates that painful experiences can significantly affect the fear of cancer recurrence among cancer survivors, which is a distressing concern that influences both physiological and psychological recovery. Yet, the role of potential factors and mechanisms in these relationships is not fully known. This cross-sectional study aimed to advance our comprehension of the associa-tions between total pain and the fear of recurrence in post-treatment cancer patients by examining two potential mediators: psychological flexibility and mentalization. Three hundred and thirty-five participants (aged 22 to 88, 49.1% female) who had finished their cancer treatment completed self-report assessments of total pain, fear of recurrence, psychological flexibility, and mentalization. The serial mediation analysis showed that all dimensions of total pain were positively related to the fear of recurrence indirectly through psychological flexibility and mentalization, in serial. Additionally, gender moderated these serial mediational effects. In line with the psychological flexibility model, personal capacities to face difficult internal/external problems and interpret one’s behaviour in motivational terms can counterbalance patients’ negative emotions and feelings related to the illness.

Cancer diagnosis stands at the cusp of a profound transformation, driven by the burgeoning capabilities of Artificial Intelligence (AI) and Machine Learning (ML). This comprehensive review illuminates the extraordinary impact of AI and ML in the field, unraveling their multifaceted roles in the realm of oncology. In the arena of cancer diagnosis, AI and ML serve as invaluable allies, empowering healthcare professionals with unparalleled tools for precision and efficiency. Notably, AI's prowess in analyzing medical images, including radiological scans and pathology slides, elevates the early detection of malignancies to new heights. Coupled with its ability to dissect genomic data, AI tailors therapeutic strategies to the individual, promising optimized treatment outcomes. However, the incorporation of AI and ML into clinical practice necessitates a careful navigation of ethical considerations, data privacy, and regulatory landscapes. Safeguarding patient data, ensuring transparency, and addressing algorithmic biases emerge as pivotal challenges that require vigilant attention. Yet, the future of AI and ML in cancer diagnosis is brimming with promise. The integration of multi-modal data, real-time monitoring, and Explainable AI (XAI) methods holds the potential to enrich diagnostic capabilities and engender patient trust. Global collaboration and data sharing initiatives are fostering the development of robust AI models. Furthermore, AI's role in cancer prevention, identifying high-risk individuals and enabling targeted preventive strategies, is poised to revolutionize healthcare. AI and ML are forging a path toward an era of unparalleled accuracy, efficiency, and personalization in cancer diagnosis. Challenges notwithstanding, these technologies bear the promise of fundamentally reshaping patient care, elevating outcomes, and advancing the fight against cancer. The ongoing exploration and responsible implementation of AI and ML in oncology will be pivotal in harnessing their full potential and paving the way for a brighter future for cancer patients.

Marine microalgae are a rich reservoir of natural compounds, including bioactives. Nonetheless, these organisms remain fairly unexplored despite their potential biotechnological applications. Culture collections with diverse taxonomic groups and lifestyles are a good source to unlock this potential and discover new molecules for multiple applications such as the treatment of human pathologies or the production of aquaculture species. In the present work extracts from 33 strains (including 20 dinoflagellates, 4 diatoms and 9 strains from other 7 algal classes), cultivated under identical conditions were examined for antiviral, antibacterial, anti-inflammatory and anti-cancer activities. Among these, antiviral and anti-inflammatory activities were detected in a few strains while antibacterial tests showed positive results in most assays. In turn, most trials did not show any anti-cancer activity. Wide differences were observed between species within the same class, in particular dinoflagellates which were better represented in this study. These preliminary findings pave the way for in-depth characterization of extracts with highest signals in each test, identification of compounds responsible of the biological activities found, and a further screening of the CCVIEO culture collection.

Background: Cell proliferation and the cell cycle are fundamental to tumor development, with mitosis playing a crucial role in cell division. Understanding the complexities of the cell cycle and mitosis is critical for cancer research, especially in the context of developing therapeutic strategies. Objective: This review highlights mitotic poisons as potential anti-cancer pharmacotherapeutics, particularly their structural and functional group diversity presenting opportunity for semi-synthesis of new derivatives with multi-target mechanisms relevant for cancer pharmacotherapeutics. Also, the review explores naturally occurring mitotic poisons and inhibitors of microtubule-dependent molecular motors as promising cancer pharmacotherapeutics. Methods: A comprehensive review of literature from 2004 to 2023 was conducted, covering studies on cell proliferation, mechanism of cell cycle regulation, mitosis, cytokinesis, and anti-cancer drug development. The published literature was collected primarily from PubMed, Scopus, Medline, Web of Science Core Collections, Google Scholar and other relevant scientific databases using keywords including but not limited to mitotic poisons and cancer, sources of mitotic poisons, mechanism of mitotic poisons, targets of mitotic poisons and structural diversity of mitotic poisons. The efficacy and limitations of various mitotic poisons and their impact on different cancer types were examined. Recent advancements in targeted therapeutic interventions for various cancers were also explored. Results: The effectiveness and limitations of mitotic poisons, including Taxanes, Epothilones, Colchicine, Vinca alkaloids, Berberine, Laulimalide, and Pseudolaric acid B, were highlighted. Drugs targeting mitotic kinases such as CDKs, Aurora kinases, PLK1, and WEE1 inhibitors were reported. Inhibiting kinesin motor proteins such as Eg5 and KIF15 to interfere with spindle formation and cell division were discussed, along with specific genomic alterations in KIF genes and the discovery of KIFC1 as potential for future research and drug development. Conclusion: Targeting microtubules and mitotic kinases, along with inhibiting kinesin motor proteins, show promise for cancer pharmacotherapeutics. The combination of targeted therapies, patient stratification based on biomarkers (such as low alpha-1 acid glycoprotein and high p63 expression), and exploration of alternative natural sources of mitotic poisons and analogues can significantly advance cancer pharmacotherapy to improve patient outcomes.

Focused microwave breast hyperthermia (FMBH) employs a phased antenna array to perform beamforming that can focus microwave energy at targeted breast tumors. Selective heating of the tumor endows the hyperthermia treatment with high accuracy and low side effects. The effect of FMBH is highly dependent on the applied phased antenna array. This work investigates the effect of polarizations of antenna elements on the microwave focusing results by simulations. We explore two kinds of antenna arrays with the same number of elements using different digital realistic human breast phantoms. The first array has all the elements’ polarization in the vertical plane of the breast while the second array has half elements’ polarization in the vertical plane and the other half in the transverse plane, i.e., cross polarization. In total 96 sets of different simulations are performed, and the results show that the second array leads to a better focusing effect in dense breasts than the first array. This work is very meaningful for the potential improvement of the antenna array for FMBH, which is of great significance for the future clinical applications of FMBH. The antenna array with cross polarization can also be applied in micro-wave imaging and sensing for biomedical applications.

Chromosomal instability (CIN), defined by variations in the number or structure of chromosomes from cell to cell, is recognized as a distinctive characteristic of cancer, associated with the ability of tumors to adapt to challenging environments. CIN has been recognized as a source of genetic variation that leads to clonal heterogeneity (CH). Recent findings suggest a potential association between CIN and CH with the prognosis of BC patients, particularly in tumors expressing the epidermal growth factor receptor 2 (HER2+). In fact, information on the role of CIN in other BC subtypes, including luminal B BC, is limited. Additionally, it remains unknown whether CIN in luminal B BC tumors, above a specific threshold, could have a detrimental effect on the growth of human tumors, or if low or intermediate CIN levels could be linked to a more favorable BC patient prognosis when contrasted with elevated levels. Clarifying these relationships could have a substantial impact on risk stratification and the development of future therapeutic strategies aimed at targeting CIN in BC. This study aimed to assess CIN and CH in tumor tissue samples from ten patients with luminal B BC, and compared them with established clinicopathological parameters. The results of our study show that luminal B BC patients exhibit intermediate CIN and stable aneuploidy, both of which correlated with lymphovascular invasion. These findings suggest that evaluating CIN, CH and aneuploidy could improve risk stratification, the prediction of clinical outcomes and future therapeutic approaches in luminal B BC patients.

Most patients with pancreatic cancer at some point present with symptoms related to exocrine pancreatic insufficiency (EPI). These include diarrhea, abdominal bloating, indigestion, steatorrhea, weight loss, and anorexia. Even though up to 80% of pancreatic cancer patients eventually present with symptoms related to exocrine pancreatic insufficiency, only 21% are prescribed pancreatic enzyme replacement therapy. This treatment is profoundly underutilized in the palliative care of these patients. The objective of this review is to discuss the pharmacology, pharmacokinetics, side effects, available evidence of effectiveness of pancreatic enzyme use for patients with pancreatic cancer, and challenges along with proposed solutions regarding its use. Pancrelipase is an expensive drug, and it is inactive if not taken correctly. The impact of symptoms of EPI can lead to poorer overall well-being. Pharmacists play a crucial role in properly educating patients on the correct use of pancreatic enzyme replacement therapy. Pancreatic enzyme replacement therapy (PERT) is a key strategy in managing symptoms of EPI and can improve quality of life, which is a central focus in palliative care.

The high prevalence of thyroid nodules and increased availability of neck ultrasound have led to an increased incidence of diagnostic thyroid fine needle aspirations, with approximately 20% yielding indeterminate results. The recent availability of molecular tests has helped guide the clinical management of these cases. This paper aims to review and compare three main commercially available molecular cytology platforms in the U.S. – Afirma GSC, Thyroseq GC, and ThyGeNEXT+ThyraMIR. Sequential improvements of the Afirma GSC and Thyroseq GC tests have led to higher positive and negative predictive values, sensitivity, and specificity. Comparative studies revealed similar diagnostic performance between these tests, with considerations for factors such as cost and processing time. Thyroseq GC provides detailed genomic information and specific management recommendations. ThyGeNEXT+ThyraMIR, though less studied, presents promising results, particularly in miRNA analysis for weak driver mutations. Challenges in interpreting results include variations in reporting and the evolving nature of testing platforms. Questions persist regarding cost-effectiveness and the utility of ultrasound characteristics in selecting candidates for molecular testing. While molecular testing has primarily served diagnostic purposes, advancements in understanding genetic alterations now offer therapeutic implications. FDA-approved options target specific genetic alterations, signaling a promising future for tailored treatments.

Cadmium (Cd) is an environmental toxicant of worldwide public health significance. Diet is the main non-workplace Cd exposure source other than smoking. The intestinal absorption of Cd involves the transporters for iron, zinc, copper, and calcium. These metal transporters essentially determine the body burden of Cd because only 0.001-0.005% of Cd accumulated in the body can be excreted in urine each day. The International Agency for Research on Cancer listed Cd as a human lung carcinogen. Current evidence, however, suggests that environmental Cd may increase the prevalence of many types of cancer, notably lung, liver, breast, pancreas, and kidney. A two-year bioassay that mimics a lifelong exposure demonstrates Cd caused neoplasms in multiple tissues of mice. Also, several non-tumorigenic human cell lines underwent malignant cell transformation, when they were exposed to a sublethal dose of Cd for a prolonged time. Cd does not directly damage DNA, but it can profoundly affect gene expression through its interactions with various proteins, and Cd can thus be viewed as a transcription modulator. The present review highlights epidemiological studies that connected an enhanced risk of various neoplastic diseases to chronic exposure to environmental Cd. Special emphasis is on the impact of body iron stores on the absorption rate of Cd, and its implications for breast cancer prevention in highly susceptible subpopulation groups of women. Resistance to cell death and other cancer phenotypes acquired during Cd-induced cancer-cell transformation, under in vitro conditions, are briefly discussed. The potential role for ZnT1 efflux transporter in cellular acquisition of tolerance to Cd cytotoxicity are highlighted.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Ganoderma lucidum, commonly known as the "Lingzhi" or "Reishi" mushroom, has long been recognized for its potential health benefits, and medicinal properties in traditional Chinese medicine. In recent years, the emerging field of nanotechnology has opened up new possibilities in order to use the remarkable properties of G. Lucidum at the nanoscale. The unique combination of bioactive compounds present in G. Lucidum, such as triterpenoids, polysaccharides, and peptides, has inspired interest in leveraging their therapeutic potential through nanotechnological approaches. Various nanomaterials, including nanoparticles, nanofibers, and nanocomposites, have been employed to encapsulate and deliver these bioactive components to target cells or tissues, enhancing stability, controlled release, and consequently their bioavailability. Nanotechnology-based strategies have been investigated for the efficient extraction and purification of bioactive compounds from G. Lucidum. The use of nanoscale materials has facilitated the extraction process, enhancing the yield and purity of the active components. Additionally, nanocarriers and nanoformulations have been developed to protect these sensitive bioactive compounds from degradation, ensuring their stability during storage and transportation. The use of G. Lucidum-based nanomaterials has shown promising results in several biomedical applications. Nanoparticles loaded with bioactive compounds derived from G. Lucidum have exhibited potent anticancer activity by targeting cancer cells, inducing apoptosis, and inhibiting tumor growth. Additionally, nanotechnology-based formulations have demonstrated immunomodulatory effects, promoting the activation of immune cells and enhancing the body's defense mechanisms. GL, combined with the potential of nanotechnology, presents an exciting frontier in the development of novel therapeutic and biomedical applications. The utilization of nanomaterials for extraction, delivery, and integration of bioactive compounds from G. Lucidum has shown immense potential for improving drug delivery, tissue engineering, and disease treatment. Further research and development in this interdisciplinary field are warranted to fully exploit the synergistic benefits offered by G. Lucidum, and nanotechnology, ultimately leading to innovative solutions for human health and well-being.

Introduction: Colorectal cancer (CRC) is a disease of colon or rectum the part of digestive system. DNA methylation is a process of gene expression by recruiting protein which involve in gene repression, or inhibiting the binding of transcription factors to DNA. MicroRNAs (miRNAs) have been attracting major interest as potential biomarker in cancer. Hereditary nonpolyposis of colorecta cancer (HNPCC) is a type of genetic change (mutation) in a family. Our aims to do a systematic review on DNA methylation and miRNAs serve as candidate clinical biomarkers in HNPCC. Materials and methods: Electronic databases (Medline, PubMed and Scopus data bases). We searched to identify publication all over the world related colorectal cancer and miRNA. Selection was based on the design (CRC, invasive CRC, Colon or rectum, HNPCC, microRNA, circulating miRNA, non-coding RNA), 87 papers from PubMed and 15 papers from Scopus were selected all over the world. CRC, target antigens, methodologies used for detection and miRNA expression were identified and summarized. Results: A total of 96 articles were searched, 87 articles from scopus and 9 articles from PubMed. 20 duplicates removed and remain 76, 52 excluded after screened the titles and abstracts; and remain 24, 10 full texts articles were excluded with reason, and 14 identifications were included in the studies. Conclusion: The findings of this systematic review showed that DNA methylation and mircroRNA in HNCC patients as a genetic mutation or a promoter in colorectal cancer.

Cancer patients undergoing major interventions face numerous challenges, including the adverse effects of cancer and the side effects of treatment. Cancer rehabilitation is vital in ensuring cancer patients have the support they need to maximise treatment outcomes and minimise treatment-related side effects and symptoms. The Active Together service is a multi-modal rehabilitation service designed to address critical support gaps for cancer patients. The service is located and provided in Sheffield, UK, an area with higher cancer incidence and mortality rates than the national average. The service aligns with local and regional cancer care objectives and aims to improve clinical and quality of life outcomes of cancer patients by using lifestyle behaviour change techniques to address their physical, nutritional, and psychological needs. This paper describes the design and initial implementation of the Active Together service, highlighting its potential to support and benefit cancer patients.

Background: Breast cancer is a commonly diagnosed cancer worldwide. Human MutT homolog 1 (MTH1) is found to be elevated in breast tumors and cancer cells are addicted to MTH1 for sur-vival. Pharmacological inhibition of MTH1 may be potentially beneficial in the treatment of breast cancer. Methods: MA-24 was screened by malachite green colorimetric assay from MTH1 inhibitors and the kinetic characteristics of MA-24 was assessed. Binding features of MA-24 with MTH1 was as-certained through molecular docking, and cytotoxic activity of MA-24 was validated in vitro and in vivo. Target engagement assays, comet assay and western blot confirmed that the intracellular target and mechanism of MA-24. Results: MA-24 with potent antitumor bioactivity both in vitro and in vivo. MA-24 competitively inhibited the MTH1 and further induce DNA strand breaks, leading to increased apoptosis of cancer cells depending on upregulation of cleaved-caspase 3 – cleaved-PARP axis. Especially, MA-24 exhibited a powerful efficacy and safety in vivo (tumor growth inhibition rate: 61.8%). Conclusions: MA-24 possesses a broad spectrum of breast cancer cytotoxicity and offered valuable insights for overcoming the challenges of chemotherapy-related toxicity, which holds great po-tential for further development MA-24 as an anti-cancer drug.

Background: Approximately 75% of all head and neck cancer patients are treated with radiotherapy (RT). RT to the oral cavity results in acute and late adverse events which can be severe and detrimental to a patient’s quality of life and function. The purpose of this study was to explore associations between RT dose to a defined oral cavity organ at risk (OAR) avoidance structure, provider and patient reported outcomes (PROs), opioid use, and hospitalization. Methods: This was a retrospective analysis of prospectively obtained outcomes using multivariable modeling. The study included 196 patients treated with RT involving the oral cavity for a head and neck tumor. A defined oral cavity OAR avoidance structure was used in all patients for RT treatment planning. Validated PROs were collected prospectively. Opioid use and hospitalization were abstracted electronically from medical records. Results: Multivariable modeling revealed the mean dose to the oral cavity OAR was significantly associated with opioid use (p=0.0082) and hospitalization (p=0.0356) during and within 30 days of completing RT. Conclusion: The findings of this study may be valuable in RT treatment planning for patients with tumors of the head and neck region to reduce the need for opioid use and hospitalization during treatment.

Breast cancer is the most common cancer among women worldwide, and estrogen receptor-positive (ER+) breast cancer accounts for a significant proportion of cases. While various treatments are available, endocrine therapies are often the first-line treatment for this type of breast cancer. However, the development of drug resistance poses a significant challenge in managing this disease. ESR1 mutations have been identified as a common mechanism of endocrine therapy resistance in ER+ breast cancer. The first-generation selective estrogen receptor degrader (SERD) fulvestrant has shown some activity against ESR1 mutant tumors. However, due to its poor bioavailability and need for intramuscular injection, it may not be the optimal therapy for patients. Second-generation SERDs have been developed to overcome these limitations. These newer drugs have improved oral bioavailability and pharmacokinetics, making them more convenient and effective for patients. Several oral SERDs are now in phase III trials for early and advanced ER+ breast cancer. This review summarizes the background of oral SERD development, the current status, and future perspectives.

In Caucasians, basal cell carcinoma, a type of non-melanoma skin cancer, is most often found on the nose. This presents challenges for surgeons due to anatomical, functional, and aesthetic concerns. The study aimed to evaluate the distribution of tumor localization, size, morphological subtypes, surgical outcomes, radicality levels, and their correlation with recurrence rates. The research utilized data from the Hygiene Institute Health Information Centre. A retrospective analysis encompassed 343 cases of nasal skin cancer over a four-year period from January 1, 2019, to December 31, 2022. The research cohort comprised 252 female and 91 male participants, averaging 75,2 years old. Tumors were most found on the left sidewall of the nose (25.4%) and the dorsum (24.8%). The infiltrative morphological subtype was predominant (70.8%). Standard surgical excision with fasciocutaneous plastic was the preferred surgical procedure. Radical excision was achieved in 79.0% of lesions, while 16.9% were incompletely excised. Non-radically excised tumors exhibited a significantly higher recurrence rate (24.1%) compared to those with radical excision (6.3%). In nasal reconstruction, diverse surgical techniques are essential for precise adaptation based on factors like tumor characteristics and patient needs. Despite surgeons' careful adherence to excision guidelines, the potential for non-radical procedures cannot be entirely eliminated.

(1) Background: P-cadherin (CDH3) is a transmembrane protein that plays a crucial role in maintaining the structural integrity of epithelial tissue and homeostasis. Its role in carcinogenesis remains a subject of debate, as its behavior can vary depending on the molecular context and the specific tumor cell model under study. In this study, we explored the role of P-cadherin in head and neck squamous cell carcinoma (HNSCC) and the mechanism underlying its function. (2) Methods: We analyzed P-cadherin expression in HNSCC patients using The Cancer Genome Atlas (TCGA) database. For in vitro functional analysis, we conducted proliferation, migration, invasion, and western blot assays after either suppressing or overexpressing P-cadherin. For in vivo functional analysis, we utilized mouse xenograft models. (3) Results: P-cadherin was significantly overex-pressed in tumor samples compared to normal samples in the TCGA-HNSCC cohort. P-cadherin knockdown resulted in decreased proliferation, migration, and invasion compared to control cells, while P-cadherin overexpression increased cell proliferation and migration in HNSCC cells. We discovered that c-Met functioned as an upstream regulator of P-cadherin. Surprisingly, we found that P-cadherin knockdown increased the phosphorylation of c-Met and STAT3. Combining P-cadherin siRNA with the c-Met inhibitor SU11274 resulted in a more effective reduction in HNSCC cell growth, both in vitro and in vivo, compared to either treatment alone. (4) Conclusions: Our study uncovered a previously unknown aspect of P-cadherin-mediated c-Met regulation. The enhanced activation of c-Met/STAT3 following P-cadherin inhibition could be responsible for the survival of resistant tumor cells. Therefore, dual inhibition of P-cadherin and c-Met may be a potentially effective approach for treating HNSCC.

: Nanotechnology has expanded what can be achieved in our approach to cancer treatment. The ability to produce and engineer functional nanoparticle formulations to elicit higher incidences of tumor cell radiolysis has resulted in substantial improvements in cancer cell eradication while also permitting multi-modal biomedical functionalities. These radiosensitive nanomaterials utilize material characteristics, such as radio- blocking/absorbing high-Z atomic number elements, to mediate localized effects from therapeutic irradiation. These materials thereby allow for subsequent scattered or emitted radiation to produce direct (e.g., damage to genetic materials) or indirect (e.g., protein oxidation, reactive oxygen species formation) damage to tumor cells. Using nanomaterials that activate under certain physiologic conditions such as the tumor micro-environment can selectively target tumor cells. These characteristics combined with biological interactions that can target the tumor environment allow for localized, radio-sensitization while mitigating damage to healthy cells. This review explores the various nanomaterial formulations utilized in cancer radiosensitivity research. Emphasis on inorganic nanomaterials showcase the specific material characteristics that enable higher incidences of radiation while ensuring localized cancer targeting based on tumor micro-environment activation. The aim of this review is to guide future research in cancer radiosensitization using nanomaterial formulations and to detail common approaches to radiosensization, as well their relations to commonly implemented radiotherapy techniques.

Next-generation cancer and oncology research needs to take full advantage of the multi-modal structured, or graph, information, with the graph datatypes ranging from molecular structures to spatially resolved imaging and digital pathology to biological networks to knowledge graphs. Graph Neural Networks (GNNs) efficiently combine the graph structure representations with the high predictive performance of deep learning, especially on the large multi-modal datasets. In this review article, we survey the landscape of recent (2020-present) GNN applications in the context of cancer and oncology research, and delineate six currently predominant research areas. Subsequently, we identify the most promising directions for future research. We compare GNNs with graphical models and "non-structured" deep learning, and devise the guidelines for cancer and oncology researchers or physician-scientists asking the question of whether they should adopt the GNN methodology in their research pipelines.

Lung cancer (LC) stands as the foremost cause of cancer-related fatality rates worldwide. Early diagnosis significantly enhances patient survival rate. Nowadays, low dose computed tomography (LDCT) is widely employed on chest as a tool for large-scale lung cancer screening. Nonetheless, a large amount of chest radiographs causes an onerous burden on radiologists. Some computer-aided diagnostic (CAD) tools can provide insights to medical images for diagnosis and augmenting diagnostic speed. However, due to variation in parameter settings across different patients, substantial discrepancies in image voxels persist. We find different voxel-size causing a compromise between model generalization and diagnostic efficacy. This study investigates the performance disparities of diagnostic models trained on original images and LDCT images reconstructed to different voxel-sizes but isotropic. The application is to differentiate a nodule to be benign or malignant. Using 11 features, a support vector machine (SVM) is trained on LDCT images with an isotropic voxel having side-length of 1.5 mm for 225 patients in house. The result yields a favorable model performance with an accuracy of 0.9596 and an area under the receiver operating characteristic curve (ROC/AUC) of 0.9855. In addition to furnish CAD tools for clinical applications, future research is encouraged to include LDCT images from multi-centers.

Introduction and objectives Obstructive sleep apnea (OSA) is defined as a cause of daytime sleepiness, as well as a clinical manifestation of sleep-disordered breathing. In the literature, there are numerous controversial studies regarding the etiology of this condition, but it is universally accepted that a significant role in its onset is played by the reduced activity of the upper airway muscles. Additionally, OSA has been associated with a series of comorbidities, such as type II diabetes, metabolic syndrome, cardiovascular and pulmonary conditions, as well as head and neck tumors, especially oropharyngeal and laryngeal tumors. The purpose of this review is to examine and demonstrate the prevalence of OSA in patients with associated pathologies, especially in patients with head and neck tumors, as well as the role of surgical and non-surgical therapeutic methods in improving the quality of life. Material and methods Taking into consideration the stated objective, a systematic analysis of the available literature was conducted, encompassing PubMed, Medline and Scopus databases. The evaluation was based on several keywords, including head and neck cancer, diabetes, diabetic, overlap syndrome, cardiovascular conditions, laryngeal neoplasm, radiotherapy, chemotherapy, as well as the concept of quality of life in laryngectomized patients and patients with OSA. Results Our results demonstrate the involvement of OSA in the presence of comorbidities and also, an increased incidence of OSA in patients with laryngeal cancer. It is important to note that surgical and post-surgical treatment can play a significant role in triggering OSA in these patients. Conclusions The clinician must recognize the increased prevalence of OSA in patients with head and neck cancer, as well as the coexistence of OSA with certain comorbidities. They should actively engage in early diagnosis and establish optimal treatment methods to improve the quality of life for patients with associated conditions such as head and neck tumors or cardiovascular pathology.

Once discovered, cancer stem cells have become a hot topic in the research of cancer therapy. These cells possess stem cell-like self-renewal and differentiation capacities and are important factors that dominate cancer metastasis, therapy- resistance and recurrence. What's worse, their own characteristics make them difficult to be eliminated. Colorectal cancer is the third most common cancer and the second leading cause of cancer death worldwide. Targeting colorectal cancer stem cells (CRCSCs) can inhibit colorectal cancer metastasis, enhance therapeutic efficacy, and reduce recurrence. Here, we introduced the origin, marker proteins, identification, cultivation and research techniques of CRCSCs, summarized the signaling pathways that regulate the stemness of CRCSCs, such as Wnt, JAK/STAT3, Notch, and Hh signaling pathway. In addition to these, we also reviewed anti-CRCSC drugs targeting signaling pathways，markers，and other regulators in recent years. These will help researchers gain insight into the current agents targeting to CRCSCs, explore new cancer drugs, and propose potential therapy.

Breast cancer is a common malignant tumour and studies have shown that early and accurate detection is crucial for patients. With the maturity of medical imaging and deep learning development, significant progress has been made in breast cancer classification, which greatly improves the accuracy and efficiency of classification. This review focuses on deep learning, migration learning, GAN, and lifelong learning to elaborate and summarise the important roles arising from breast cancer detection. This review also examines the dataset and labeling issues required for breast cancer classification. In conclusion, at the end of the article, we look at future directions for breast cancer classification research, including cross-migration learning, multimodal data fusion, model interpretability, and lifelong learning, and also explore how to provide personalized treatment plans for patients.

Colorectal liver metastases (CRLM) patients combined with hepatic lymph node metastases was a negative prognostic factor associated with outcomes. Up to now, there was still lack of a reliable method to identify the status of hepatic lymph nodes. The aim of this study was to investigate the predictive ability of mono-exponential, bi-exponential, and stretched-exponential diffusion-weighted imaging (DWI) models to distinguish between benign and malignant hepatic lymph nodes in CRLM patients who underwent neoadjuvant chemotherapy prior to surgery. In total, 97 CRLM patients with pathologically proved hepatic lymph node status were included. Various quantitative parameters, including the apparent diffusion coefficient (ADC) from mono-exponential model, D, D*, and f derived from intravoxel incoherent motion (IVIM) model, as well as DDC and α from stretched-exponential model (SEM), were measured. Multivariate analysis revealed that the pre- treatment DDC value and the short diameter of the largest lymph node after treatment were independent predictors of metastatic hepatic lymph nodes. A nomogram combining these two factors demonstrated excellent performance in distinguishing between benign and malignant lymph nodes in CRLM patients, with an area under the curve (AUC) of 0.873. Therefore, the nomogram can serve as a preoperative assessment tool for determining the status of hepatic lymph nodes and aiding in the decision-making process for surgical treatment in CRLM patients.

Recent studies suggest that PEBP1/RKIP and YY1, despite having distinct molecular functions, may interact and mutually influence one another's activity. They exhibit reciprocal control over each other's expression through regulatory loops, prompting the hypothesis that their interplay could be pivotal in cancer advancement and resistance to drugs. To delve into this interplay's functional characteristics, we conducted a comprehensive analysis using bioinformatics tools across a range of cancers. Our results confirm the association between elevated YY1 mRNA levels and varying survival outcomes in diverse tumors. Furthermore, we observed differing degrees of inhibitory or stimulatory effects of these two genes in various cancer pathways, along with correlations between their mRNA expression and immune infiltration. Additionally, YY1/PEBP1 expression (or methylation) displayed connections with genomic alterations across cancer types. Notably, we uncovered links between YY1/PEBP1 and different indicators of immunosuppression, such as immune checkpoint blockade response, and T-cell dysfunction/exclusion levels, across different patient groups. Overall, our findings underscore the significant role of the interplay between YY1 and PEBP1 in cancer progression, influencing genomic changes, tumor immunity or the tumor microenvironment. Additionally, these two gene products appear to impact the sensitivity of anticancer drugs, opening new avenues for cancer therapy.

Background: Epithelial-mesenchymal transition (EMT) is a biological process where epithelial cells lose their adhesive properties and gain invasive, metastatic, and mesenchymal properties. Maintaining the balance between epithelial and mesenchymal stage is essential for tissue homeo-stasis. Many of the genes promoting mesenchymal transformation has been identified; however, our understanding of the genes responsible for maintaining the epithelial phenotype is limited. Our objective was to identify genes responsible for maintaining the epithelial phenotype and in-hibiting EMT. Methods: RNA seq was performed using an vitro model of EMT. CTGF expres-sion was determined by qPCR and Western blot analysis. Knockout of CTGF was done using the CTGF sgRNA CRISPR/CAS9. Tumorigenic potential was determined using NCG mice. Results: Knocked-out of CTGF in epithelial ovarian cancer cells leads to the acquisition of functional characteristics associated with the mesenchymal phenotype such as Anoikis resistance, cytoskel-eton remodeling, increased cell stiffness, and acquisition of invasion and tumorigenic capacity. Conclusions: We identified CTGF is an important regulator of the epithelial phenotype, and its loss is associated with early cellular modifications required for EMT. We describe a novel role for CTGF, regulating cytoskeleton and the extracellular matrix interactions necessary for conserva-tion of epithelial structure and function. These findings provide a new window to understand the early stages on mesenchymal transformation

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Breast cancer is the most common malignancy in women worldwide. The pathogenesis of this disease is closely related to the estrogen receptor alpha subtype (ERα). Therefore, it is of great importance to develop effective inhibitors of ERα activity for the treatment of breast cancer. In this paper, we propose a novel ensemble machine learning model for quantitative structure-activity relationship of anti-breast cancer drugs, which can effectively predict drug activity in small samples with multiple characteristic variables. To avoid the problem of over-fitting caused by low-correlation independent variables, the scoring mechanism of random forest was improved by incorporating three relevance indicators, including the maximum mutual information number, Pearson correlation coefficient and distance correlation coefficient, and 20 optimal molecular descriptors were selected. The Bayesian hyperparameter optimization method was used to optimize the parameters of multiple linear regression (MLR), support vector regression (SVR), and extreme gradient boosting (XGBoost), respectively. The AdaBoost strong learner was constructed by combining the weak learner with the weighted linear addition method. The results show that the proposed ensemble learning model has the best prediction performance compared to the three basic learner models and the CNN-LSTM combination prediction model. The root mean square error was reduced by 7.60%-26.51%. The mean relative error was reduced by 6.46%-30.92%. Goodness of fit increased by 9.57%-36.94%. Finally, the biological activities of 50 candidate compounds for ERα inhibitors were predicted, and it was found that 4-[2-benzyl-1-[4-(2-pyrrolidin-1-ylethoxy)phenyl]but-1-enyl]phenol had an excellent biological activity value pIC50, which had the potential to be an ERα inhibitor. The model proposed in this paper has good prediction accuracy, which can provide an effective reference for the discovery and development of anti-breast cancer drugs.

Frontal Temporal Dementia (FTD) is a neurological disorder known to have less therapeutic options. So far only a few biomarkers are available for FTD that can be used as potential comorbidity targets. To this end, in the present study we aim to identify potential biomarkers or susceptible genes for FTD that show comorbidities with diseases such as COVID-19 and Breast Cancer. Gene expression Omnibus datasets containing FTD expression profiles from African American and white ethnicity background were included in our study. In FTD samples of GSE193391 dataset, we identified 305 DEGs with 168 genes being up-regulated and 137 genes being down-regulated. We conducted comorbidity analysis for COVID-19 and Breast cancer followed by analysis of potential drug interactions, pathogenicity, analysis of genetic variants and functional enrichment analysis. Resulting genes AKT3, GFAP, ADCYAP1R1, VDAC1, and C4A showed significant transcriptomic alterations in FTD and significant comorbidity status with COVID-19 and Breast cancer. Functional pathway analysis revealed that these comorbid genes were significantly enriched in the pathways such as glioma, JAK/STAT signaling, systematic lupus erythematosus, neurodegeneration-multiple diseases and neuroactive ligand-receptor interaction. Overall, from these results, we concluded that these genes could be recommended as potential therapeutic targets for the treatment of comorbidities in FTD.

A comprehensive lipid profile was analyzed in patients with non-small cell lung cancer (NSCLC) using nanoflow ultrahigh-performance liquid chromatography-electrospray ionization-tandem mass spectrometry. The study investigated 297, 202, and 166 lipids in saliva, plasma, and fecal samples, respectively, comparing NSCLC patients to healthy controls. Lipids with significant changes (&gt;2-fold, p&lt;0.05) were further analyzed in each sample type. Both saliva and plasma exhibited similar lipid alteration patterns in NSCLC, but saliva showed more pronounced changes and fecal lipids had weak correlation with those of saliva and plasma. Total triglycerides (TGs) increased (&gt;2–3 folds) in plasma and saliva but decreased in fecal samples. Three specific TGs (50:2, 52:5, and 54:6) were significantly increased in NSCLC across all sample types. A common ceramide species (d18:1/24:0) decreased in both plasma and saliva but increased in fecal samples. Additionally, phosphatidylinositol 38:4 decreased by approximately 2-fold in plasma and saliva. Phosphatidylserine 36:1 was selectively detected in saliva and showed a subsequent decrease, making it a potential biomarker for predicting lung cancer. The study identifies 27 salivary, 10 plasma, and 16 fecal lipids as candidate markers for NSCLC by statistical evaluations. Moreover, it highlights the potential of saliva in understanding changes in lipid metabolism associated with NSCLC.

Perfluorohexane sulfonate (PFHxS) is a widely detected replacement for legacy long-chain perfluoroalkyl substances (PFAS) in the environment and human blood samples. Its potential toxicity led to its recent classification as a global regulated persistent organic pollutant. Although animal studies have shown a positive association between PFHxS levels and hepatic steatosis and hepatocellular hypertrophy, the link with liver toxicity, including end-stage liver cancer, remains inconclusive. In this study, we examined the effects of PFHxS on the proliferation of human hepatocellular carcinoma (HCC) cells, Hep3B and SK-Hep1. Cells were exposed to different PFHxS concentrations for 24–48 hr to assess viability and 12–14 days to measure colony formation. Viability of both cell lines increased at PFHxS concentrations <200 μM, decreased at >400 μM, and were highest at 50 μM. Colony formation increased at <300 μM and decreased at 500 μM PFHxS. Consistent with the effect on HCC proliferation, PFHxS increased expression of proliferating cell nuclear antigen (PCNA) and cell-cycle molecules (CDK2, CDK4, cyclin E, and cyclin D1). In summary, PFHxS exhibited a biphasic effect on HCC cell proliferation, promoting survival and proliferation at lower concentrations and being cytotoxic at higher concentrations. This suggests that PFHxS potentially exacerbates HCC progression.

Aortic valve stenosis and malignancy frequently coexist and share the same risk factors as atherosclerotic disease. Data reporting the prognosis of patients with severe aortic stenosis and cancer are limited. Tailoring the correct and most optimal care for cancer patients with severe aortic stenosis is complex. Cancer patients may be further disadvantaged by aortic stenosis if it interferes with their treatment by increasing the risk associated with oncologic surgery and compounding the risks associated with cardiotoxicity and heart failure (HF). Nowadays, several therapeutic options are available for aortic valve stenosis (surgical valve replacement , transcatheter valve implantation, balloon valvuloplasty, or medical therapy), but in presence of malignancy, the use of one of these versus the others should be decided on a case-by-case approach, depending on cancer stage and associated treatment, expected outcome, comorbidities and after an accurate physical examination and Doppler-echocardiography which are the key tools for diagnosing and evaluating aortic stenosis. The current review considers the available data on the association between aortic stenosis and cancer, and therapeutic options.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Background: This study assessed the nephrotoxicity of oral BRAF inhibitors (BRAFi), regorafenib (REG) and encorafenib (ENC), in metastatic colorectal cancer (mCRC), through an analysis of re-ports from the US Food and Drug Administration's Adverse Event Reporting System (FAERS) da-tabase. Methods: A descriptive and disproportional analyses were performed for all reports with ENC and REG as the primary suspect. Results: A total of 379 reports had at least one renal ADR, mainly related to REG (93.1%). Potential safety signals for REG particularly included chromaturia (n = 44; ROR = 12.00, CI 95% = 8.92-16.16; IC = 2.36, IC025-IC075 = 2.06-2.66), hydronephrosis (10; 8.70, 4.67-16.19; 1.85, 1.23-2.47), nephrotic syn-drome (7; 5.73, 2.73-12.03; 1.47, 0.73-2.21), renal impairment (53; 4.16, 3.17-5.45; 1.39, 1.12-1.66), dys-uria (19; 3.06, 1.95-4.81; 1.06, 0.61-1.52), renal failure (38; 1.66, 1.20-2.28; 0.49, 0.17-0.81), and acute kidney injury (AKI) (43; 1.46, 1.08-1.97; 0.37, 0.07-0.67). For ENC, consistent disproportionalities were observed for AKI (n = 11; ROR = 3.79, CI 95% = 2.09-6.90; IC = 1.32, IC025-IC075 = 0.72-1.91) and dysuria (4; 6.50, 2.43-17.39; 1.86, 0.88-2.85). Conclusions: These findings highlighted some not extensively reported renal ADRs that required further investigations to better characterize the safety profile of BRAFi in patients with mCRC.