Volatile compounds, abundant in breath, can be used to accurately diagnose and monitor a range of medical conditions. This offers a non-invasive, low-cost approach with screening applications; however, uptake of this diagnostic approach has been limited by conflicting published outcomes. Most published reports rely on large scale screening of the public, at single time points and without reference to ambient air. Here, we present a novel approach to volatile sampling from cellular headspace and mouse breath that incorporates multi-time point analysis and ambient air subtraction revealing compound flux as an effective proxy of active metabolism. This approach to investigating breath volatiles offers a new avenue for disease biomarker discovery and diagnosis. Using gas chromatography mass spectrometry (GC/MS), we focus on low molecular weight, metabolic substrate/by-product compounds and demonstrate that this non-invasive technique is sensitive (reproducible at ~1 µg cellular protein, or ~500,000 cells) and capable of precisely determining cell type, status and treatment. Isolated cellular models represent components of larger mammalian systems and we show that stress- and pathology-indicative compounds are detectable in mice, supporting further investigation using this methodology as a tool to identify volatile targets in human patients.

Magnetic resonance elastography (MRE) has revealed sexual dimorphism in brain stiffness in healthy individuals and multiple sclerosis (MS) patients. In the animal model of MS, experimental autoimmune encephalomyelitis (EAE), we showed previously that inflammation-induced brain softening was associated with alterations of the extracellular matrix (ECM). However, it remained unclear whether the brain ECM presents sex-specific properties that can be visualized by MRE. Therefore, we aimed here at quantifying sexual dimorphism in brain viscoelasticity in association with ECM changes in healthy and inflamed brains. Multifrequency MRE was applied to the midbrain of healthy and EAE mice of both sexes to quantitatively map regional stiffness. To define differences in brain ECM composition, gene expression of the key basement membrane components laminin (Lama4, Lama5), collagen (Col4a1, Col1a1) and fibronectin (Fn1) was investigated by RT-qPCR. We showed that the healthy male cortex expressed less Lama4, Lama5, Col4a1 but more Fn1 (all p < 0.05) than the healthy female cortex, which was associated with 9% softer properties (p = 0.044) in that region. At peak EAE, cortical softening was similar in both sexes compared to healthy tissue, with an 8% difference remaining between males and females during EAE (p < 0.001). Cortical Lama4, Lama5 and Col4a1 expression increased 2 to 3-fold in EAE in both sexes while Fn1 decreased only in males (all p < 0.05). No significant sex differences in stiffness were detected in other brain regions. In conclusion, sexual dimorphism in the ECM composition of cortical tissue in the mouse brain is reflected by in vivo stiffness measured with MRE and should be considered in future studies by sex-specific reference values.

The article delves into the intricate phase transitions of 1-Octadecanol and n-Nonadecane within a binary system, unveiling dynamic structural changes under varying conditions. Through Fouri-er-transform infrared (FTIR) analysis, specific molecular vibrations were identified, shedding light on the molecular composition and interactions. The study highlights the challenges in detecting subtle phase transitions and emphasizes the individuality of molecular behaviours in closely related compounds. The findings underscore the complexity of phase transitions in binary systems and advocate for a nuanced approach to studying molecular structures and behaviours. Addi-tionally, the research contributes valuable insights into the molecular dynamics of Organic Polymer Functional Adsorption Materials, offering implications for synthetic waxy layers in plant epidermis.

Previous studies have quantified repolarization variability using time-domain, frequency-domain and non-linear analysis in mouse hearts. Here, we investigated the relationship between these parameters and ventricular arrhythmogenicity in a hypokalaemia model of acquired long QT syndrome. Methods: Left ventricular monophasic action potentials (MAPs) were recorded during right ventricular regular 8 Hz pacing during normokalaemia (5.2 mM [K+]), hypokalaemia modelling LQTS (3 mM [K+]) or hypokalaemia with 0.1 mM heptanol in Langendorff-perfused mouse hearts. Results: During normokalaemia, mean APD was 33.5±3.7 ms. Standard deviation (SD) of APDs was 0.63±0.33 ms, coefficient of variation was 1.9±1.0% and the root mean square (RMS) of successive differences in APDs was 0.3±0.1 ms. Low- and high-frequency peaks were 0.6±0.5 and 2.3±0.7 Hz, respectively, with percentage powers of 38±22 and 61±23%. Poincaré plots of APDn+1 against APDn revealed ellipsoid morphologies with SD along the line-of-identity (SD2) to SD perpendicular to the line-of-identity (SD1) ratio of 4.6±1.1. Approximate and sample entropy were 0.49±0.12 and 0.64±0.29, respectively. Detrended fluctuation analysis revealed short- and long-term fluctuation slopes of 1.62±0.27 and 0.60±0.18, respectively. Hypokalaemia provoked ventricular tachycardia in six of seven hearts, prolonged APDs (51.2±7.9 ms), decreased SD2/SD1 ratio (3.1±1.0), increased approximate and sample entropy (0.68±0.08 and 1.02±0.33) and decreased short-term fluctuation slope (1.23 ± 0.20) (ANOVA, P<0.05). Heptanol prevented VT in all hearts studied without further altering the above repolarization parameters observed during hypokalaemia. Conclusion: Reduced SD2/SD1, increased entropy and decreased short-term fluctuation slope are associated with ventricular arrhythmogenesis in hypokalaemia. Heptanol exerts anti-arrhythmic effects without affecting repolarization variability.

Background: The effectiveness of the anti-COVID-19 vaccine remains a matter to be clarified. Methods: The humoral and cellular immunity after the administration of three doses of the Pfizer–BioNTech and Oxford AstraZeneca vaccines against SARS-CoV-2 over one year and the appearance of post-vaccination COVID-19 have been studied. Results: Anti-SARS-CoV-2 IgG and IgA antibodies showed a progressive increase throughout the vaccination period. This increase was greatest after the third dose. The highest levels were observed in subjects who had anti-SARS-CoV-2 antibodies prior to vaccination. There was an increase in CD4+ αβ, CD8+ γδ and TEM CD8+ γδ T cells, and a decrease in apoptosis in CD4+CD8+ and CD56+ αβ and γδ T cells. Post-vaccination SARS-CoV-2 infection was greater than 60%. The symptoms of COVID-19 were very mild and were related to γδ T cell deficit, specifically CD8+ TEMRA and CD56+ γδ TEM, as well as lower pre-vaccine apoptosis levels. Conclusions: Those results demonstrate the important role that γδ T cells play in SARS-CoV-2 vaccine immunization.

The COVID-19 pandemic over the past years has shown a great need for rapid, low-cost and on-site detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). In this paper, an aptamer-based colloidal gold nanoparticle lateral flow test strip was well developed to realize the visual detection of wild type SARS-CoV-2 spike protein (SP) and multiple variants. Under the optimal reaction conditions, a low detection limit of SARS-CoV-2 S protein of 0.68 nM was acquired, and the actual detection recovery was 83.3% to 108.8% for real world samples. This suggests a potential tool for the prompt detection of SARS-CoV-2 with good sensitivity and accuracy, and a new method for the development of alternative antibody test strips for the detection of other viral targets.

In Cameroon, Aedes mosquitoes transmit various arboviruses, posing significant health risks. We aimed to characterize the Aedes virome in southwestern Cameroon and identify potential core viruses which might be associated with vector competence. A total of 398 Aedes mosquitoes were collected from four locations (Bafoussam, Buea, Edea and Yaounde). Aedes albopictus dominated all sites except for Bafoussam where Aedes africanus prevailed. Metagenomic analyses of mosquitoes grouped per species into 54 pools revealed notable differences in eukaryotic viromes between Ae. africanus and Ae. albopictus, with the former exhibiting greater richness and diversity. Thirty-seven eukaryotic virus species from 16 families were identified, including six novel viruses with near complete genome sequences. Seven viruses were further quantified in individual mosquitoes via qRT-PCR. Although none of them could be identified as core viruses, Guangzhou sobemo-like virus and Bafoussam mosquito solemovirus virus were highly prevalent regionally in Ae. albopictus and Ae. africanus, respectively. This study highlights the diverse eukaryotic virome of Aedes species in southwestern Cameroon. Despite their shared Genus, Aedes species exhibit limited viral sharing, with varying viral abundance and prevalence across locations. Ae. africanus, an understudied vector, harbors a rich and diverse virome, suggesting potential implications for arbovirus vector competence.

Background Sarcopenia is a state with progressive and generalized loss of skeletal muscle mass and strength. It is a serious complication occurring in chronic kidney disease (CKD) patients which increases morbidity and mortality rate. Sarcopenia is diagnosed when loss of both compartments - muscle strength and skeletal muscle quality or quantity are present. However, there are still numerous patients, also with CKD, diagnosed as pre-sarcopenic individuals with low muscle strength and normal skeletal muscle quality or quantity and conversely, with correct muscle strength and decreased skeletal muscle mass, who are prone to develop sarcopenia in future life. It is crucial to examine numerous variables possibly associated with changes of skeletal muscle mass and muscle strength in terms of preventing the development of sarcopenia. The aim of the study was to investigate anthropometric and clinical correlates and sources of variation in both skeletal muscle mass and muscle strength in advanced stages of CKD. Methods The study sample consisted of 84 non-dialysis dependent patients of both sexes (including 45.2% of women) with eGFR < 45 ml/min/1.73m²: 26.2% with eGFR 30-44 mL/min/1.73 m², 65.5% with eGFR 15-29 mL/min/1.73 m² and 8.3% with eGFR < 15 mL/min/1.73 m². Muscle strength was estimated by measuring hand grip strength (HGS) with the use of handheld hydraulic dynamometer. Muscle quantity was measured by bioimpedance spectroscopy using Body Composition Monitor. Appendicular skeletal muscle mass (ASM) was calculated according to Lin’s formula. Serum creatinine, urea, uric acid and albumin were measured. Results In bivariate analysis we found that ASM significantly and positively correlated with anthropometric variables such as body mass (r=0.903, p<0.001), NH weight (r=0.882, p<0.001), height (r=0.694, p<0.001), body mass index (BMI) (r=0.701, p<0.001), lean tissue mass (LTM) (r=0.664, p<0.001), lean tissue index (LTI) (r=0.433, p<0.001), fat mass (r=0.614, p<0.001) and fat tissue index (FTI) (r=0.449, p<0.001), and was negatively associated with clinical variable such as hydration status (p<0.001). HGS significantly and positively correlated with anthropometric parameters such as body mass (r=0.319, p=0.003), NH weight (r=0.315, p=0.004), height (r=0.666, p<0.001), LTM (r=0.490, p<0.001), LTI (r=0.238, p=0.029), and ASM (r=0.501, p<0.001), and was negatively associated with clinical variables like uric acid (p=0.039) and urea (p<0.001). After adjustment for age, sex and height, HGS remained significantly and negatively related with uric acid (β=-1.078, p=0.041) and hydration status (β=-0.805, p=0.042). Conclusions In CKD patients, ASM is determined mainly by anthropometric parameters but HGS - both by anthropometric and clinical variables specific for CKD.

The treatment of acute myeloid leukemia (AML) with adverse genetics remains unsatisfactory, with very low response rates to standard chemotherapy and shorter durations of remission commonly observed in these patients. The complex biology of AML with adverse genetics is continuously evolving. Herein, we discuss recent advances which have investigated the contribution of cell intrinsic mechanisms as well as of the immune system to myeloid leukemogenesis in this specific subset of AML. We focus on the biological rationales for combining targeted therapy and immunotherapy, which are currently being investigated in ongoing trials, and could hopefully ameliorate the poor outcomes for these patients

Originating in the Mediterranean, B. oleracea is grown all over the world and is highly valued for its nutritional value and variety in cooking. Its susceptibility to pests, diseases, and environmental stressors, however, poses significant challenges to sustaining consistent crop quality and productivity. The BASIC PENTACYSTEINE gene significantly impacts plant growth and responses to abiotic stresses. Nevertheless, little is known about its precise role and the underlying biological processes in B. oleracea. Eleven BPC genes in B. oleracea were identified by a thorough genome-wide investigation and categorized into three categories according to their structural traits and gene motifs. There were eight different chromosomes on which these BoBPCs were located. Comparative synteny analysis was used to reveal the evolutionary traits of potatoes, Arabidopsis, and B. oleracea. The BoBPC family genes in B. oleracea were found to have specific cis-elements linked to growth, stress responses, and hormone regulation when their promoter regions were studied. Cuticular wax synthesis expression revealed that all BoBZR1 genes, from wild to mutant, expressed at varied amounts in distinct types. Moreover, distinctive BoBPC gene expression patterns were found in the seven distinct tissues that were studied. Our thorough analysis shows that the BoBPC family is widely involved in B. oleracea developmental processes. The present findings provide an established theoretical basis for further exploration into the composition and roles of BoBPC in B. oleracea.

Most research on colostrum quality and colostrum management focuses on maternal IgG transfer to the newborn calf. However, in addition to being a source of antibodies, colostrum has other components that influence passive immune transfer, nutrition, gut maturation, and thermoregulation. In this review, the constituents in the bovine colostrum, as well as their variation, are explored and it is discussed the biological role of colostrum on the newborn calf. Protein is the nutrient in higher concentration and fat is the nutrient with the most variation. There is a pronounced amplitude in the total solids content of colostrum, but the average concentration does not vary much between studies (24.7%). Bovine colostrum major components can vary with several factors, such as the region, season, breed, dry period length, and nutritional aspects of the dam. Bioactive components, cells, and microbiome variability are less understood, besides IgG. Regardless, they play crucial distinct roles in the physiological development of the newborn. However, a multi-interactive effect between these components, cells, and microorganisms is more likely to occur. Recently researched components in colostrum like miRNA, nucleo(t)sides, the milk fat globule membrane, oligosaccharides, minor proteins, and the microbiome are examples of promising interest areas of study.

In mammals, the role of interleukin-18 (IL-18) in the immune response is to drive inflammatory and, normally therefore, anti-viral responses. IL-18 also shows promise as a vaccine adjuvant in mammals. Chicken IL-18 (chIL-18) has been cloned. The aim of this study was to investigate the potential of chIL-18 to act as a vaccine adjuvant in the context of a live recombinant Fowlpox virus vaccine (fpIBD1) against Infectious bursal disease virus (IBDV). fpIBD1 protects against mortality, but not against damage to the bursa of Fabricius caused by IBDV infection. The Fowlpox virus genome itself contains several candidate immunomodulatory genes, including potential IL-18 binding proteins (IL-18bp). We have knocked out (Δ) the potential IL-18bp genes in fpIBD1 and inserted (::) the cDNA encoding chIL-18 into fpIBD1 in the non-essential ORF030, generating five new viral constructs –fpIBD1::chIL-18, fpIBD1ΔORF073, fpIBD1ΔORF073::chIL-18, fpIBD1ΔORF214 and fpIBD1ΔORF214::chIL-18. The subsequent protection from challenge with virulent IBDV, as measured by viral load and bursal damage, given by these altered fpIBD1 strains, was compared to that given by the original fpIBD1. The results show that chIL-18 can act as a vaccine adjuvant, giving complete protection against challenge, with no detectable virus or damage in the bursa of Fabricius.

Based upon a radically new approach, this paper describes a 2-box absolute flow model that calculates the CO₂ transfer between the atmosphere and a terrestrial / ocean mixing reservoir. Given the inputs of anthropogenic fossil fuel emissions (CO2ff), atmospheric CO₂ mixing-ratio and nuclear weapons bomb yields, the model calculates atmospheric d¹³C and Δ¹⁴C time-series, with the level of agreement for d¹³C being to within ± 0.05 ‰, for Δ¹⁴C to within ± 3‰, spanning 200 years. The model contains only seven internal parameters which are varied to optimize the fit. Yet according to conventional wisdom, this model should not work. It is commonly held that the ¹³C and ¹⁴C isotopic forms of carbon bypass seawater carbonate chemistry, resulting in very different absorption properties (Revelle factor) as compared to ¹²C. This study rejects this assumption, and uses the same residence time and reservoir mixing properties for all isotopes. The paper includes an analysis justifying why the isotopic bypass of the Revelle factor is not significant. The study describes the use of the model to track CO2ff takeup using two separate measures, a) the amount of molecular CO2ff remaining in the atmosphere and b) the amount of atmospheric growth attributable to CO2ff, thereby resolving discrepancies in published values.

Inflammatory bowel diseases, which consist of chronic inflammatory conditions of the colon and the small intestine, are considered a global disease of our modern society. Recently, the interest toward the use of herbal therapies for the management of inflammatory bowel diseases has increased because of their effectiveness and favorable safety profile, compared to conventional drugs. Boswellia serrata Roxb. and Curcuma longa L. are amongst the most promising herbal drugs, however, their clinical use in inflammatory bowel diseases is limited and little is known on their mechanism of action. The aim of this work was to investigate the effects of two phytochemically characterized extracts of B. serrata and C. longa in an in vitro model of intestinal inflammation. Their impact on cytokine release and reactive oxygen species production, as well as the maintenance of the intestinal barrier function and on intestinal mucosa immune cells infiltration, has been evaluated. The extracts showed a good protective effect on the intestinal epithelium at 1 µg/ml, with TEER values increasing by approximately 1.5 fold, compared to LPS-stimulated cells. C. longa showed an anti-inflammatory mechanism of action, reducing IL-8, TNF-α and IL-6 production by approximately 30%, 25% and 40%, respectively, compared to the inflammatory stimuli. B. serrata action was linked to its antioxidant effect, with ROS production being reduced by 25%, compared to H₂O₂-stimulated Caco-2 cells. C. longa and B. serrata resulted to be promising agents for the management of inflammatory bowel diseases by modulating in vitro parameters which have been identified in the clinical conditions.

This study represents a significant stride in advancing furan chemistry, presenting the synthesis of high-molecular-weight polyfurfuryl alcohol (PFA) resin (Mw = 118,959 g/mol) from furfuryl alcohol (FA) using a co-catalytic system as against the conventional single-catalytic methods. The resulting PFA resin is fully characterised, and we conclude that it exhibits good shelf life and potential in diverse applications, serving as a standalone moulded material or contributing to composites, coatings, adhesives, and nanostructured carbons.

Fe[C5H5N]2[N(CN)2]2 (1) was synthesized from a reaction of stoichiometric amounts of NaN(CN)2 and FeCl2·4 H2O in a methanol/pyridine solution. Single-crystal and powder diffraction show that 1 crystallizes in the monoclinic space group I2/m (no. 12), different from Mn[C5H5N]2[N(CN)2]2 (P21/c, no. 14) due to tilted pyridine rings, with a = 7.453(7) Å, b = 13.167(13) Å, c = 8.522(6) Å, β = 114.98(6)° and Z = 2. ATR-IR, AAS, and CHN measurements confirm the presence of dicyanamide and pyridine. Thermogravimetric analysis shows that π-stacking interactions of the pyridine rings play an important role in structural stabilization. Based on DFT-optimized structures, a chemical bonding analysis was performed using a local-orbital framework by projection from a plane-wave basis. The resulting bond orders and atomic charges are in good agreement with the expectations based on the structure analysis. SQUID magnetic susceptibility measurements show a high-spin state FeII compound with predominantly antiferromagnetic exchange interactions at lower temperatures.

COVID-19, caused by SARS-CoV-2, was first identified in China in 2019. The exact origin of the disease remains uncertain, with theories suggesting it may have emerged from animals or accidentally leaked from a research laboratory. If the hypothesis that COVID-19 originated from a research laboratory is accurate, it is crucial to investigate potential pathways for pathogens to escape from biocontainment research animal facilities (BRAFs). We examine key biosafety issues associated with BRAFs, including inadequate decontamination procedures for water and experimental samples, handling high biosafety level pathogens in lower level laboratories, risks of animal bites and sharps injuries, contamination of bedding and enrichment materials, and improper management and transportation of biohazard samples. Additionally, we discuss the role of veterinarians in African research animal facilities and the challenges they encounter in maintaining biocontainment standards. We emphasize the importance of routine monitoring of effluent water to detect possible disease outbreaks. We recommend a thorough investigation of the COVID-19 pandemic to identify potential sources of pathogen release from BRAFs, which could serve as hotspots for future disease outbreaks. Findings from such investigations will inform the development of policies aimed at safeguarding human populations from future pandemics and preventing BRAFs from becoming sources of infectious disease outbreaks.

Porous β-tricalcium phosphate (Ca3(PO4)2; β-TCP) was prepared by freeze-drying and the effects of this process on pore shapes and sizes were investigated. Various samples were prepared by freezing β-TCP slurries above a liquid nitrogen surface at −180 °C with subsequent immersion in liquid nitrogen at −196 °C. These materials were then dried under reduced pressure in a freeze-dryer after which they were sintered by heating. Compared with conventional heat-based drying, the resulting pores were more spherical, which increased both the mechanical strength and porosity of the β-TCP. These materials had a wide range of pore sizes from 50 to 200 µm, with the mean and median values both approximately 100 µm regardless of the freeze-drying conditions. Mercury porosimetry data showed that the samples contained small, interconnected pores with sizes of up to 1.24 µm and macroscopic, interconnected pores up to 25.8 µm in size. The effects of non-ionic surfactants having different hydrophilic/lipophilic balance (HLB) values on foaming and pore size were also investigated. Materials made with surfactants having lower HLB values exhibited smaller pores and lower porosity whereas higher HLB surfactants gave higher porosity and slightly larger macropores. Even so, the pore diameter could not be readily controlled solely by adjusting the HLB value. The findings of this work indicated that high porosity (75%) and good compressive strength (&gt;2 MPa) can both be obtained in the same porous material and that foaming agents with HLB values between 12.0 and 13.5 were optimal.

Endocrine disruptors are molecules that can interfere with the proper functioning of the endocrine system and lead to harmful effects in living organisms. This review focuses on the impact of synthetic fragrances, which are commonly found in personal care and household products, on the endocrine system. The article discusses the different types of hormones in the body and how they interact with receptors to produce signals. It also explores how endocrine disruptors can interfere with hormone signaling and transport, leading to adverse effects in the body. This work underscores the crucial need for further research into the impact of synthetic fragrances on the endocrine system and the importance of using safer alternatives in personal care and household products.

The World Health Organization declared the coronavirus disease 2019 (COVID-19) pandemic in 2020, following which a global genetic vaccination program has been rapidly implemented as a fundamental solution. However, it has been reported worldwide that the modified mRNAs encoding spike proteins and lipid nanoparticles, which are used as drug delivery systems, not only cause thrombosis and cardiovascular disorders post vaccination, but might also cause diverse diseases involving all organs and systems, including the nervous system. Furthermore, the toxicity and pathogenicity of spike proteins may necessitate defining these proteins as nonbiological infective material. Based on these reports and the abundant evidence that has come to light in the past few years, this paper aims to draw the attention of medical professionals to the various risks associated with transfusion using blood products derived from long COVID patients or from genetic vaccine recipients, and to make proposals regarding specific inspection items, testing methods, regulations, etc. This paper provides insights to address the post-vaccination syndrome and its consequences following such genetic vaccination programs.

Background: Bariatric surgery (BS) has a significant impact on body composition (BC) and con-sequently may affect established sarcopenic obesity (SO) in candidate patients. The aim of this study is to assess the utility of muscle ultrasound (MUS) of rectus femoris thickness (RFT) for the evalua-tion of BC and skeletal muscle function in patients undergoing BS compared to bioimpedance analysis (BIA), dual-energy X-ray absorptiometry (DEXA) and dynamometry. On the other hand, we aim to demonstrate how MUS of RFT correlates better with the quality of life (Qol) in this population, likely because it enables the detection of regional quadriceps muscle sarcopenia, in comparison to the other mentioned methods. Methods: This is a prospective pilot study including 77 subjects (64.9% female, mean age: 53.2 ± 8.67 years) who underwent BS. Handgrip strength was measured using a dynamometer, fat-free mass index (iFFM) was assessed by BIA, appendicular muscle index (AMI) was calculated using DEXA and RFT was measured by MUS. Moreover, Homeostasis Model Assessment of Insulin Resintance (HOMA-IR) was calculated. All these measurements were conducted 1 month prior to BS and at the 12-month follow-up. QoL was as-sessed using the Moorehead-Ardelt questionnaire. Results: The mean BMI decreased by 12.95 ± 3.56 kg/m2 (p=0.001). Firstly, we observed positive correlation pre-surgery between HOMA and: RFT (r=0.27, p=0.02), iFFM (r=0.36, p=0.001), AMI (r=0.31, p=0.01) and dynamometer (r=0.26, p=0.02). In addition, we found correlation between RFT and iFFM (pre-surgical: r=0.31, p=0.01; post-surgical: r=0.25, p=0.05) and between RFT and lower extremities AMI post-surgical (r=0.27, p=0.04). Secondly, we observed significant reductions in iFFM, AMI and RFT (p=0.001), but not with dynamometer (p=0.94). Finally, a tendency to a positive correlation between QoL question-naire and RFT post-surgery (r=0.23, p=0.079) was observed. Conclusions: Our results suggest that RFT measured by MUS for the evaluation of SO and the follow-up after BS of these patients. Moreover, RFT can provide relevant information about regional sarcopenia and probably has an accurate correlation with QoL in comparison with the other methods.

Semi-continuous data are very common in the social science and economics. In this paper, a Bayesian variable selection procedure is developed to assess the influence of exogenous factors including observed and unobserved on the semi-continuous data. Our formulation is based on the two-part latent variable model with polytomous response. We consider two schemes for the penalties of regression coefficients and factor loadings: the Bayesian spike and slab bimodal prior and the Bayesian lasso prior. Within the Bayesian framework, we implement Markov Chains Monte Carlo sampling method to conduct posterior inference. To facilitate posterior sampling, we recast the logistic model in part one as the norm-like mixture model. Gibbs sampler is designed to draw observations from the posterior. Our empirical results show that with suitable hyper-parameters, the spike and slab bimodal method slightly outperforms the Bayesian lasso in the current analysis. Finally, a real example related to the China household finance survey is analyzed to illustrate the application of the methodology.. .

Meloidogyne nematodes, commonly known as root-knot nematodes, pose a considerable threat to crop yields, resulting in significant economic losses due to their intricate biology and limited control methods. In line with the European Union's focus on promoting organic farming and soil health to encourage sustainable agricultural practices, this study explores the efficacy of two characterized bacterial communities obtained from compost, namely SynCom1 and SynCom2, against Meloidogyne javanica in tomato plants. Through pot experiments, it is demonstrated that both bacterial communities effectively suppress nematode reproduction and root infections while simultaneously enhancing various growth parameters in tomatoes. These findings underscore the potential of synthetic bacterial communities as promising tools for organic or integrated pest management, thereby supporting sustainable agricultural practices and contributing to improved crop yields.

The Imbalance Cost Pass-Through (ICPT) is a flexible component of the Incentive Regulation (IBR) that empowers power producers to adjust tariffs in response to variable fuel prices, thereby enhancing the economic resilience of electricity generation. However, the cost of electricity generation is significantly influenced by the volatility of commodity prices, including coal, gas and LNG. In Malaysia, the Energy Commission has conducted biannual reviews of fuel and other generation costs. Any cost savings or increases identified during these reviews will be passed on to customers in the form of rebates or surcharges. Due to that reason, this study proposes ICPT price forecasting for the electricity market in Peninsular Malaysia. The study aims to construct an ICPT-related baseline model for the peninsular generation data by employing three forecasting methods. The forecasting performance is analysed by a Mean Absolute Percentage Error (MAPE). In findings, the ARIMA method is one of the most accurate forecasting methods for fuel prices compared to the Moving Average (MA) and LSSVM methods. The observed price differences between the ARIMA and LSSVM models for ICPT are minimal. The ICPT price for July-December 2022 and January-June 2023 is MYR 0.21/ kWh for ARIMA and MYR 0.18/kWh for LSSVM, which are close to the actual TNB’s ICPT tariff. As for the forecasting, the ICPT price is expected to drop for the next announcement. The findings of this study may contribute to a positive impact on the sustainability of the energy sector in Malaysia.

Aquaporin-11 (AQP11) is an intracellular water channel expressed at the endoplasmic reticulum (ER) of the kidney proximal tubule. Its gene disruption in mice leads to intracellular vacuole formation at one week old and the subsequent development of polycystic kidneys at three week old. As the damaged proximal tubular cells with intracellular vacuoles later form cysts, autophagy may play a role in their survival. We examined the autophagy activity before and after the development of cysts in AQP11(-/-) kidneys. We first observed an enhanced expression of LC3 gene (Map1lc3b) as well as other autophagy-related genes in AQP11(-/-) mice by quantitative PCR analysis. We then examined the formation of autophagosomes visualized by a green fluorescent fusion protein, GFP–LC3 in its transgenic mice. The expression of GFP-LC3 puncta was increased in the proximal tubule of AQP11(-/-) mice before the cyst formation. Interestingly, they were also observed in the cyst-lining epithelial cell. Further PCR analyses revealed the enhanced expression of apoptosis- and ER stress-related caspase genes before and after the cyst formation suggesting that ER stress may have enhanced autophagy. We conclude that autophagy will play an important role in the development and the survival of the kidney cysts in AQP11(-/-) mice.

The dynamic landscape of AI adoption and its impact on employment in Malaysia demands a multifaceted approach to navigate the challenges and harness the opportunities presented. While the government's commitment to fostering AI adoption through initiatives like the National AI Framework and the Malaysia Digital Economy Blueprint is commendable, it is imperative to address concerns regarding job displacement and ensure inclusive growth. This study identifies the pressing research problem of workforce readiness for the AI-driven future, emphasizing the need to explore strategies for reskilling and upskilling affected workers. By employing critical lenses such as Marxist, feminist, and postcolonial perspectives, scholars highlight the power dynamics and societal implications inherent in AI deployment, guiding the development of policies and interventions that prioritize workers' interests and address social inequalities. Moving forward, a comprehensive approach combining policy interventions, educational reforms, and inclusive strategies is essential to maximize the benefits of AI adoption while mitigating its potential risks. Longitudinal studies, interdisciplinary research, and comparative analyses will further advance our understanding and inform evidence-based policymaking in this evolving field. Ultimately, by prioritizing workforce preparedness, social equity, and sustainable development, Malaysia can position itself as a leader in the AI-driven global economy, fostering a resilient, inclusive, and prosperous society for all.

The early 2-factor (E2F) family of transcription factors, including E2F1-8, plays a critical role in apoptosis, metabolism, proliferation, and angiogenesis within glioblastoma (GBM). However, the specific functions of E2F transcription factors (E2Fs) and their impact on the malignancy of Bevacizumab (BVZ)-responsive GBM subtypes remain unclear. This study used data from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) to explore the impact of eight E2F family members on the clinical characteristics of BVZ-responsive GBM subtypes and possible mechanisms of recurrence after BVZ treatment.To predict the possibility of GBM patient survival and progression, we classified and comparedthe expression of E2Fs according to BVZ-responsive subtypes and employed a machine learning method-TreeBagger, one random forest algorithm. Multiple bioinformatics analyses have shown that the significant increased E2F8 post BVZ treatment may enhance the function of angiogenesis and stem cell proliferation, indicating one of the mechanisms of GBM recurrence after treatment. In addition, BVZ treatment in unresponsive GBM patients may potentially worsen disease progression. Our findings suggest that E2F family members play important roles in GBM malignancy and BVZ treatment response, highlighting their potential as prognostic biomarkers and therapeutic targets and recommending precise BVZ treatment for GBM patients.

Antibodies are important tools for the study of membrane proteins in biological, biophysics and structural analyses. However, the production of purified membrane proteins is still a formidable challenge due to the amphipathic character and inherent instability of these proteins. In this work, we tested a strategy for producing antibodies against an ATP-Binding Cassette (ABC) transporter without the need to produce the full membrane complex. Instead, just the extra cytoplasmic regions of the ABC-type transporter Rv1819c from Mycobacterium tuberculosis were presented in the RAD-display, a scaffold system based on the engineered Pyrococcus furiosus RadA protein developed for exposition of peptides. The RadA scaffold protein is highly stable, can tolerate long insertions and easy to produce in Escherichia coli. Based on the three-dimensional structure of Rv1891c, we selected two versions of the main extracellular loops of the permease to use as test cases for this approach. Rv1819c-derived peptides displayed on RAD display system were used for immunization of mice and production of polyclonal antibodies. These antibodies were able to recognize the transporter in M. tuberculosis cell extracts, on intact cells by flow cytometry and as purified protein. The results showed the approach can be a useful tool for in vitro analyses, screening, and evaluation of different epitopes in membrane proteins.

How hematopoietic stem and progenitor cell (HSPC) fate decisions are affected by genetic alterations acquired during AML leukemogenesis is poorly understood and mainly explored in animal models. Here, we studied isocitrate dehydrogenases (IDH) genes mutations in the human model of HSPC and provide a review of the literature on this topic. IDH1/2 mutations occur in ~20% of AML, are recognized among the mutations earliest acquired during leukemogenesis, and are target of specific inhibitors (ivosidenib and enasidenib, respectively). In order to investigate the direct effects of these mutations on the HSPC we expressed by lentiviral transduction either IDH1-R132H or IDH2-R140Q mutants into human CD34+ healthy donor cells and analyzed the colony-forming unit (CFU) ability. CFU ability was dramatically compromised with a complete trilineage block of differentiation. Strikingly, the block was reversed by the specific inhibitors, confirming it was a specific effect induced by the mutants. In line with this observation, the CD34+ leukemic precursors isolated from a patient with IDH2-mutated AML at baseline and during enasidenib treatment showed over time a progressive and marked improvement of their fitness in terms of CFU ability and propensity to differentiate, attaining clonal trilinear reconstitution of hematopoiesis and complete hematological remission.

RNA sequencing techniques, like bulk RNA-seq and Single Cell (sc) RNA-seq, are critical tools for the biologist looking to analyze the genetic activity/transcriptome of a tissue or cell during an experimental procedure. Platforms like Illumina's next-generation sequencing (NGS) are used to produce the raw data for this experimental procedure. This raw FASTQ data must then be prepared via a complex series of data manipulations by bioinformaticians. This process currently takes place on an unwieldy textual user interface like a terminal/command line that requires the user to install and import multiple program packages, preventing the untrained biologist from initiating data analysis. Open-source platforms like Galaxy have produced a more user-friendly pipeline, yet the visual interface remains cluttered and highly technical, remaining uninviting for the natural scientist. To address this, SeqMate is a user-friendly tool that allows for one-click analytics by utilizing the power of a large language model (LLM) to automate both data preparation and analysis (differential expression, trajectory analysis, etc). Furthermore, by utilizing the power of generative AI, SeqMate is also capable of analyzing such findings and producing written reports of upregulated/downregulated/user-prompted genes with sources cited from known repositories like PubMed, PDB, and Uniprot.

CD8+ cytotoxic T lymphocytes (CTLs) play a crucial role in anti-tumor immunity. In a previous study, we identified a subset of murine effector CTLs expressing the hepatocyte growth factor (HGF) receptor c-Met (c-Met+ CTLs) that are endowed with enhanced cytolytic capacity. HGF directly inhibited the cytolytic function of c-Met+ CTLs, both in 2D in vitro assays and in vivo, leading to reduced T cell responses against metastatic melanoma. To further investigate the role of c-Met+ CTLs in a three-dimensional (3D) setting, we studied their function within B16 melanoma spheroids and examined the impact of cell-cell contact on the modulation of inhibitory checkpoint molecules expression such as KLRG1, PD-1 and CTLA-4. Additionally, we evaluated the cytolytic capacity of human CTLs clones expressing c-Met (c-Met+) and compared it to c-Met− CTLs clones. Our results indicated that, similar to their murine counterparts, c-Met+ human CTLs clones exhibited increased cytolytic activity compared to c-Met− CTLs clones, and this enhanced function was negatively regulated by the presence of HGF. Taken together, our findings highlight the potential of targeting the HGF/c-Met pathway to modulate CTL-mediated anti-tumor immunity. This research holds promises for developing strategies to enhance the effectiveness of CTL-based immunotherapies against cancer.

Ferroptosis is a unique variety of non-apoptotic cell death, driven by massive lipid oxidation in an iron-dependent manner. Since Ferroptosis was introduced as a concept in 2012, it was shown it's essential role in the pathogenesis in neurodegenerative diseases and an important role in therapy-resistant cancer cells. Thus, a detailed molecular understanding of both canonical and alternative ferroptosis pathways are required. There is a set of widely used chemical agents to modulate ferroptosis using different pathway targets: Erastin blocks cystine-glutamate antiporter, system xc-; ML210 directly inactivate GPX4; L-buthionine sulfoximine (BSO) inhibits γ-glutamylcysteine synthetase, an essential enzyme for glutathione synthesis de novo. Most studies were focused on lipidomic profiling of model systems undergoing death in a ferroptotic modality.

Miscarriage due to blastocyst implantation failure occurs in up to two-thirds of all miscarriage cases in human. The calcium ion has been shown to be involved in many cellular signal transduction pathways as well as in the regulation of cell adhesion, which is necessary for the embryo implantation process. Exposure to endocrine-disrupting chemicals (EDs) during early gestation results in disruption of intrauterine implantation and uterine reception, leading to implantation failure. In this study, ovarian estrogen (E2), bisphenol A (BPA), or 4-tert-octylphenol (OP), with or without ICI 182,780 (ICI) were injected subcutaneously from gestation day 1 to gestation day 3 post-coitus. The expression levels of the calcium transport genes were assessed in maternal uteri and implantation sites. The number of implantation sites was significantly low in the OP group, and implantation sites were absent in the E2 and EDs+ICI groups. There were different calcium transient transport channel expression levels in uterus and implantation site samples. The levels of TRPV5 and TRPV6 gene expression were significantly increased by EDs with/without ICI treatment in uterus. Whereas, TRPV5 and TRPV6 gene expression were significantly lower in implantation sites samples. NCX1 and PMCA1 mRNA levels were significantly decreased by OP and BPA in the implantation site samples. Compared to vehicle treatment in uterus, both the MUC1 mRNA and protein levels were markedly high in all but the BPA group. Taken together, these results suggest that both BPA and OP can impair embryo implantation through alteration of calcium transport gene expressions and by affecting uterine receptivity.

Management of inflammatory bowel disease (IBD) often relies on biological and immunomodulatory agents for remission through immunosuppression, raising concerns regarding the SARS-CoV-2 vaccine's effectiveness. The emergent variants have hindered the vaccine neutralization capacity, and whether the third vaccine dose has the capacity to neutralize SARS-CoV-2 variants in this population remains unknown. This study aims to evaluate the humoral response of SARS-CoV-2 variants in patients with IBD 60 days after the third vaccine dose [BNT162b2 (Pfizer-BioNTech) or mRNA-1273 (Moderna)].56 su bjects with IBD and 12 healthy subjects were recruited. 90% of patients with IBD (49/56) were receiving biologics and/or immunomodulatory therapy. 24 subjects with IBD did not develop effective neutralizing capability against the Omicron variant. 70% (17/24) of those subjects were receiving anti-Tumor Necrosis Factor therapy [10= adalimumab, 7= infliximab], two of them had a history of COVID-19 infection, and one subject did not develop immune neutralization against three other variants: Gamma, Epsilon, and Kappa. All subjects in the control group developed detectable antibodies and effective neutralization against all seven SARS-CoV-2 variants. Our study shows that patients with IBD might not be protected against SARS-CoV-2 variants, and larger studies are needed to evaluate optimal immunity.

Outliers seriously affect the accuracy in geometric model fitting. Previous works in coping with outliers involve threshold selection and scale estimation. However most scale estimators suppose the inlier distribution as a Gaussian model, which usually poorly meets the cases in geometric model fitting. Outliers, considered as the points with big residuals to all the true models, share common items with big values in quantized residual preferences, thus making the outliers gather away from the inliers in quantized residual preference space. In this paper we make use of this outlier consensus in quantized residual preference space by extending the usage of energy minimization to combine the model error and the spatial smoothness in quantized residual preference space for outlier detection. The energy minimization based outlier detection process follows an alternate sampling and labeling framework. After the outlier detection, an ordinary energy minimization method is employed to optimize the inlier labels, which also follows the framework of alternate sampling and labeling. The experimental results in this study show that the energy minimization based outlier detection method can detect most of the outliers in the data. Furthermore, the proposed energy minimization based inlier segmentation process segments the inliers into different models quite accurately. Overall, the performance of the proposed method is better than most of the state-of-the-art methods.

Ammonia-oxidizing microorganism communities are abundant and functionally efficacious in nitrification. However, ammonia-oxidizing archaea (AOA) and ammonia-oxidizing bacteria (AOB) groups complicate this process in subtropical streams. This study investigates the abundance of ammonia-oxidizing communities south of the Dabie Mountains, China, using quantitative polymerase chain reaction (qPCR). Clone libraries were utilized to analyze the abundance and microbial structures of AOA and AOB in sediments. Such analysis may provide strong evidence reflecting the links within the environment. The results show that AOB had a lower abundance of copies of the ammonia-oxidizing gene (amoA) than AOA. Interestingly, the AOA and AOB community compositions were correlated with ecological characteristics. The dissolved oxygen (DO) and oxidation-reduction potential (ORP) had significant positive correlations, whereas the phosphorus within the structure had a negative correlation with the abundance of both groups. Our study shows that it might adopt some species related to Nitrosotalea clusters that can resist comparably higher pH (toward pH 6.5). Together, these results imply that the physiological adaptation of microbial guilds to environmental pressures in ammonia-oxidizing archaea might allow them to have a more substantial function of ammonia-oxidizing communities in natural habitats.

In plant cells the conventional route to the vacuole involves the endoplasmic reticulum, the Golgi and the prevacuolar compartment. However, over the years, unconventional sorting to the vacuole, bypassing the Golgi, has been described, which is the case of the Plant Specific Insert (PSI) of the aspartic proteinase cardosin A. Interestingly, this Golgi-bypass ability is not a characteristic shared by all PSIs, since two related PSIs showed to have different sensitivity to ER-to-Golgi blockage. Given the high sequence similarity between the PSIs domains, we sought to depict the differences in terms of post-translational modifications. In fact, one feature that draws our attention is that one is N-glycosylated and the other one is not. Using site-directed mutagenesis to obtain mutated versions of the two PSIs, with and without the glycosylation motif, we observed that altering the glycosylation pattern interferes with the trafficking of the protein as the non-glycosylated PSI-B, unlike its native glycosylated form, is able to bypass ER-to-Golgi blockage and accumulate in the vacuole. This is also true when the PSI domain is analyzed in the context of the full-length cardosin. Regardless of opening exciting research gaps, the results obtained so far need a more comprehensive study of the mechanisms behind this unconventional direct sorting to the vacuole.

This paper investigates pseudo-polymorphism in 2-pyridylmethoxy derivatives of p-tert-butylcalix[4]arene (PyC4), p-tert-butyldihomooxa-calix[4]arenes (PyHOC4), and p-tert-butylhexahomotrioxacalix[3]arenes (PyHO3C3), presenting 11 crystal structures with 15 crystallographically independent molecules. The macrocycle of PyC4 is smaller and less flexible with respect to those of PyHOC4 and PyHO3C3 and in solution, the cone conformation of these three molecules exhibit different point symmetries: C4, Cs and C3, respectively. A correlation is observed between the macrocycle's structural rigidity and the number of pseudo-polymorphs formed. The more rigid PyC4 displays a higher number (6) of pseudo-polymorphs compared to PyHOC4 and PyHO3C3, which exhibit a smaller number of crystalline forms (3 and 2, respectively). The X-ray structures obtained show that the conformation of the macrorings is primarily influenced by the presence of an acetonitrile guest molecule within the cavity, with limited impact from crystal packing and intermolecular cocrystallized solvent molecules. Notably, both calix[4]arene derivatives produce host-guest complex with acetonitrile, while the most flexible and less aromatic PyHO3C3 do not give crystals with acetonitrile as guest. Intertwined 1D and 2D solvent channel networks were observed in the PyHOC4-hexane and in the PyHO3C3-H2O-MeOH crystal structures, respectively, while the other pseudopolymorphs of PyHOC4 and PyHO3C3 and all PyC4 crystal forms exhibit a closely packed crystal structures without open channels.

Byers Peninsula is considered one of the largest ice-free areas in Maritime Antarctica. Since 2006, the Spanish Polar Program has taken part in a large number of environmental studies involving effects of climate changes in lives cycles, limnology and microbiology. Soils from maritime Antarctica are generally weakly developed and have chemical, physical and morphological characteristics strongly influenced by the parent material. However, biological activity during the short Antarctic summer promotes intense transference of nutrients and organic matter in areas occupied by different species of birds and marine mammals. To mapping and monitoring those areas with high biological occupation, could be very useful to have models of edaphic properties prepared from satellite images. In this approach, Deep Learning and Linear Regression models of soil properties and spectral indexes as explicative variables were performed. We training models of soil properties closely related to biological activity such as Dissolved Organic Carbon (DOC) and the iron fraction associated with organic matter (Fe). We tested the best approach to model the spatial distribution of DOC, Fe and pH by training models of Linear Regression and Deep Learning over Sentinel2 and WorldView2 images. The most robust models were used to track possible areas with ornithogenic soils as well as areas of the Byers Peninsula that could support the highest biological development.

Background: COVID-19 vaccines have been linked to myocarditis which in some circumstances can be fatal. This systematic review aims to investigate potential causal links between COVID-19 vaccines and death from myocarditis using post-mortem analysis. Methods: We performed a systematic review of all published autopsy reports involving COVID-19 vaccination-related myocarditis through July 3^rd, 2023. All autopsy studies that include COVID-19 vaccine-induced myocarditis as a possible cause of death were included, without imposing any additional restrictions. Causality in each case was determined by three independent reviewers with cardiac pathology experience and expertise. Results: We initially identified 1,691 studies and, after screening for our inclusion criteria, included 14 papers that contained 28 autopsy cases. The cardiovascular system was the only organ system affected in 26 cases. In 2 cases, myocarditis was characterized as a consequence from multisystem inflammatory syndrome (MIS). The mean and median number of days from last COVID-19 vaccination until death was 6.2 and 3 days, respectively. Most of the deaths occurred within a week from the last injection. We established that all 28 deaths were causally linked to COVID-19 vaccination by independent adjudication. Conclusions: The temporal relationship, internal and external consistency seen among cases in this review with known COVID-19 vaccine-induced myocarditis, its pathobiological mechanisms and related excess death, complemented with autopsy confirmation, independent adjudication, and application of the Bradford Hill criteria to the overall epidemiology of vaccine myocarditis, suggests there is a high likelihood of a causal link between COVID-19 vaccines and death from suspected myocarditis in cases where sudden, unexpected death has occurred in a vaccinated person. Urgent investigation is required for the purpose of risk stratification and mitigation in order to reduce the population occurrence of fatal COVID-19 vaccine-induced myocarditis.

This review will explore the four major pillars required for design and development of an saRNA vaccine: antigen design, vector design, non-viral delivery systems, and manufacturing (both saRNA and lipid nanoparticles (LNP)). In will report on the major innovations, preclinical and clinical data reported in the last five years and will discuss future prospects.

The emphasis in the automotive industry towards sustainable mobility has led to a significant interest in hybrid-electric propulsion systems with high energy density batteries. Addressing the needs of this strategy, the battery market is exploring new technologies to improve the safety and lifespan of electric vehicles. To this end, there is a focus on the all-solid-state battery (ASSB) technology for its cycle capabilities. Filling the current void in the literature pertaining to accurate ageing models for ASSBs, in this work, we present an enhanced version of the numerical ageing model, originally developed for liquid electrolyte based batteries, to forecast the development of the solid electrolyte interface layer that is the major cause of battery capacity fading. The model has been tested on prototype batteries and reveals an accuracy of 99%. The capacity fade in ASSBs has been investigated under different conditions, and the enhanced ageing model has been validated using experimental data from these batteries. The findings suggest that there is potential for solid-state batteries to be commercialized, although significant work is needed to match the manufacturing level of lithium-ion batteries with liquid electrolytes.

(1) Background: Patients with type 2 diabetes mellitus (T2DM) are at higher risk of cancer but how these two diseases associate is still debated. The goal was the assessment of the overall incidence of cancer among patients with newly diagnosed T2DM in Hungary. Summarizing, incident T2DM is associated with a significantly higher overall risk of incident cancer, with a reverse correlation of age. Newly registered T2DM patients were suggested to be screened for cancer within 6 months. (2) Methods: A nationwide, retrospective, longitudinal study was performed using a Hungarian database. The incident T2DM and diabetes free Hungarian population were included in the study. The primary endpoints were the overall and site-specific incidence and annual percentage change of the incidence of cancer in both populations. (3) Results: The overall incidence of cancer in patients amounted to 29.4/1000 and 6.6/1000 with or without T2DM, respectively, and the OR (95%CI) of cancer of the T2DM group was 4.32 (4.14-4.53), p&lt;0.0001. The risk of having cancer was age-dependent, having the highest odd in the age group 18-39. The incidence of cancer was declining in the non-diabetic but was unchanged in T2DM population. The average lag time of diagnosing a cancer after the detection of T2DM was 3.86 months.; (4) Conclusions: Iincident T2DM is associated with a significantly higher overall risk of incident cancer, with a reverse correlation of age. Newly registered T2DM patients were suggested to be screened for cancer within 6 months.

Globalization and digitalization have been associated with a number of challenges and opportunities. The purpose of this chapter is to analyze the impact of globalization and digitization on the Sustainable Development Goals (SDGs) and provide recommendations for achieving sustainable development. The study used a multidisciplinary approach that combined diverse research methods. This included a literature review, case studies, and empirical research findings. The findings suggest that while globalization has had both positive and negative impacts on the SDGs, it also poses challenges to social and environmental sustainability. Globalization's impact on sustainable development goals is complex and multifaceted, requiring policymakers to implement diverse measures to mitigate negative effects and promote sustainable development, particularly in less developed regions and marginalized communities. In conclusion, this chapter highlights the need for a coordinated and holistic approach to sustainable development that prioritizes the Sustainable Design Goals in policy and decision-making.

Leishmaniasis, caused by Leishmania parasites transmitted through sandfly bites, encompasses various clinical forms with distinct immune responses. Mucocutaneous leishmaniasis (ML) exhibits a delicate balance between IFN-γ and IL-10, influencing disease severity. Conversely, cutaneous leishmaniasis (CL) presents varied IFN-γ/IL-10 ratios, affecting prognosis. Leishmania RNA virus 1 (LRV1) and extracellular vesicles modulate ML immunity. In visceral leishmaniasis (VL), severe immune defects necessitate combined host immunity and drug treatment for cure. Cytokines and chemokines serve as diagnostic and prognostic markers in CL. Neutrophils' dual role in leishmaniasis pathogenesis is extensively studied, alongside the NLRP3 inflammasome's regulation of Th1/Th2 responses. Live attenuated LdCen-/- parasites offer promising VL vaccine candidates, with biomarkers like miR-21 aiding efficacy assessment. Neutrophil-DC interactions play pivotal roles in vaccine-induced immunity. Genetically modified live attenuated vaccines and novel formulations elicit robust cellular responses against VL. Understanding cytokine networks is crucial for treatment strategy development. Ongoing research strives to overcome vaccine development challenges and ensure long-term protection against leishmaniasis.

Despite the availability of effective vaccines that lower mortality and morbidity associated with COVID-19, many countries including Italy adopted strict vaccination policies and mandates to increase the uptake of the COVID-19 vaccine. Such mandates have sparked debates on the freedom to choose whether or not to get vaccinated. In this study, we examined the people’s belief in vaccine choice as a predictor of willingness to get vaccinated among a sample of unvaccinated individuals in Italy. An online cross-sectional survey was conducted in Italy in May 2021. The survey collected data on respondents’ demographics and region of residence, socioeconomic factors, belief in the freedom to choose to be vaccinated or not, risk perception of contracting and transmitting the disease, previous vaccine refusal, opinion on adequacy of government measures to address the pandemic, experience in requesting and being denied government aid during the pandemic, and intent to accept COVID-19 vaccination. The analysis employed binary logistic regression models using a hierarchical model building approach to assess the association between intent to accept vaccination and belief in the freedom to choose to vaccinate, while adjusting for other variables of interest. 984 unvaccinated individuals were included in the study. Respondents who agreed that people should be free to decide whether or not to vaccinate with no restrictions on their personal life had 85% lower odds of vaccine acceptance (OR=0.15 ;95% CI,0.09,0.23) after adjusting for demographic and socioeconomic factors and their risk perception of contracting and transmitting COVID-19. Belief in the freedom to choose whether or not to accept vaccinations was a major predictor of COVID-19 vaccine acceptance among a sample of unvaccinated individuals in Italy in May 2021. This understanding of how individuals prioritize personal freedoms and the perceived benefits and risks of vaccines, when making health care decisions can inform the development of public health outreach, educational programs and messaging.

Alphaviruses, flaviviruses, measles viruses and rhabdoviruses are enveloped single-stranded RNA viruses, which have been engineered as expression vector systems for recombinant protein expression and vaccine development. Due to the presence of non-structural genes encoding the replicase complex, a 200,000-fold amplification of viral RNA occurs in the cytoplasm of infected cells providing extreme transgene expression levels, which is why they are named self-replicating RNA viruses. Expression of surface proteins of pathogens causing infectious disease and tumor antigens provide the basis for vaccine development against infectious diseases and cancer. The self-replicating RNA viral vectors can be administered as replicon RNA, recombinant viral particles, or layered DNA/RNA replicons. Self-replicating RNA viral vectors have been applied for vaccine development against influenza virus, HIV, hepatitis B virus, human papilloma virus, Ebola virus and recently coronaviruses, especially SARS-CoV-2 the causative agent of the COVID-19 pandemic. Measles virus and rhabdovirus vector-based SARS-CoV-2 vaccine candidates have been subjected to clinical trials. Moreover, RNA vaccine candidates based on self-amplifying alphaviruses have also been evaluated in clinical settings. Various cancers such as brain, breast, lung, ovarian, prostate cancer and melanoma have also been targeted for vaccine development. Robust immune responses and protection have been demonstrated in animal models. Clinical trials have shown good safety and target-specific immune responses. Ervebo, the VSV-based vaccine against Ebola virus disease has been approved for human use.

Immune complexes (ICs) made of antibody-bound antigens exhibit immunomodulatory activities exploitable in a vaccination strategy to optimize vaccine efficacy. The modulatory effects of ICs are typically attributed to the Fc fragments of the antibody components, which engage Fc receptors, complement and complement receptors on various immune cells. These Fc-mediated functions facilitate the critical interplay between innate and adaptive immune systems to impact the quality and quantity of the elicited adaptive responses. In addition to the Fc contribution, the Fab fragment also plays an immunoregulation role. The antigen-binding domains of the Fab fragment can bind their specific epitopes at high affinity to sterically occlude these antigenic sites from recognition by other antibodies. Moreover, the Fab-mediated binding have been demonstrated to induce allosteric alterations at nearby or distant antigenic sites. In this review article, we survey published studies to illuminate how the immunomodulatory functions of ICs have been investigated or utilized in a vaccination strategy to fight against an array of infectious pathogens, culminating with IC vaccine designs aimed at preventing HIV-1 infection. In particular, we highlight IC vaccine candidates that exploit Fab-mediated steric and allosteric effects to direct antibody responses away or toward the V1V2 domain, the V3 loop, and other antigenic sites on the HIV-1 envelope gp120 glycoprotein. Like other HIV-1 vaccine approaches, the path for IC-based vaccines to reach the clinic faces major hurdles yet to be overcome; however, investigations into this vaccine strategy have provided insights into the multifaceted activities of antibodies beyond their conventional roles in the host defense against HIV-1 and other microbial pathogens.

This tutorial is organized into three major sections—viruses, vaccines and the race for a Covid-19 vaccine. The goal is to provide enough background on viruses, history of vaccines, and the science of vaccinology founded on the principles of immunity. The hope is that this will enable us to understand the challenges, methods and prospects for developing a safe and effective vaccine against SARS-CoV-2. Many important viruses such as smallpox, HIV, HCV and SARS-CoV-2 which is responsible for causing the Coronavirus disease 2019 (Covid-19) are presented in detail, which is then followed by a description of different vaccine development methods and strategies. The tutorial then discusses different candidate SARS-CoV-2 vaccines and provides specific details of many of the prospective vaccines on the leader-board which are undergoing clinical trials. The tutorial concludes with a realistic projection for a safe and effective vaccine against SARS-CoV-2 based on the historical scientific record.

The newly emerged severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has infected millions of people and caused tremendous morbidity and mortality worldwide. Effective treatment for coronavirus disease 2019 (COVID-19) due to SARS-CoV-2 infection is lacking and different therapeutic strategies are under testing. Host humoral and cellular immunity to SARS-CoV-2 infection is a critical determinant for patients’ outcome. SARS-CoV-2 infection results in seroconversion and production of anti-SARS-CoV-2 antibodies. The antibodies may suppress viral replication through neutralization but also might also participate in COVID-19 pathogenesis through a process termed antibody-dependent enhancement. Rapid progress has been made in the research of antibody response and therapy in COVID-19 patients including characterization of the clinical features of antibody responses in different populations infected by SARS-CoV-2, treatment of COVID-19 patients with convalescent plasma and intravenous immunoglobin products, isolation and characterization of a large panel of monoclonal neutralizing antibodies, as well as preliminary clinical results from several COVID-19 vaccine candidates. In this review, we summarize the recent progress and discuss the implications of these findings in vaccine development.

There is an urgent need to advance safe and affordable COVID-19 vaccines for low- and middle-income countries of Asia, Africa and Latin America. Such vaccines rely on proven technologies such as recombinant protein-based vaccines to facilitate its transfer for emerging market vaccine manufacturers. Our group is developing a two-pronged approach to advance recombinant protein-based vaccines to prevent COVID-19 caused by SARS CoV2 and other coronavirus infections. One vaccine is based on a yeast-derived (Pichia pastoris) recombinant protein comprised of the receptor binding domain (RBD) of the SARS-CoV formulated on alum and referred to as the CoV RBD219-N1 Vaccine. Potentially this vaccine could be used as a heterologous vaccine against COVID-19. A second vaccine specific for COVID-19 is also being advanced using the corresponding RBD of SARS-CoV-2. The first antigen has already undergone cGMP manufacture and is therefore “shovel ready” for advancing into clinical trials, following vialing and required GLP toxicology testing. Evidence for its potential efficacy to cross-protect against SARS-CoV-2 includes cross-neutralization and binding studies using polyclonal and monoclonal antibodies. Evidence in support of its safety profile include our internal assessments in a mouse challenge model using a lethal mouse adapted SARS strain, which show that SARS-CoV RBD 291N1 (when adsorbed to Alhydrogel®) does not elicit eosinophilic lung pathology. Together these findings suggest that recombinant protein-based vaccines based on the RBD warrant further development to prevent SARS, COVID-19 or other coronaviruses of pandemic potential.

In this paper, an adaptive proportional and integral (PI) controller for speed control of electric drives is developed. The adaptive PI controller is designed based on model reference adaptive identification and the Lyapunov function so that the system stability can be proved. To identify the inertia, the viscous friction torque coefficient, and the load torque simultaneously and smoothly, sinusoidal speed reference is usually employed. A modified motion equation considering the low-pass filter for feedback speed and the Coulomb friction torque is introduced and the relationship between the identified parameters and their actual values are clarified. A high-precision digital simulation model is built based on MATLAB/Simulink. The effectiveness of the proposed method is verified by simulations under various conditions.

High-precision conical threads are widely used in responsible joints in the drilling of oil and gas wells. Difficult underground drilling conditions due to the occurrence of significant mechanical loads and an aggressive environment in wells require the use of workable materials that are often difficult to machine. The huge need for such connections dictates the use of high-performance cutting tools, which means that high demands are placed on their effective geometric performance. The study describes the theoretical dependence of the profile precision of the tapered drill-string tool-joint threads of all standard sizes on the complex of a cutting tool geometric parameters and cutting tool setting accuracy. The experiments include an assessment of the geometric accuracy of the profile of the obtained NC23 thread connector, depending on the values of the installation angles and the declared tangential displacement of the standard threaded carbide insert.

Mutual exclusion algorithms are at the heart of concurrent, distributed/parallel, real-time and operating systems. It is well-known that such algorithms are very difficult to analyze and in the literature different conjectures about starvation-freedom and the number of by-passes (also said the overtaking factor), which in turn affects the (hopefully) bounded waiting time that a process competing for entering the critical section has to suffer before accessing the shared resource, have been formulated for specific algorithms. This paper proposes a novel modelling approach based on Timed Automata and the Uppaal toolset, which proves effective for studying all the properties of a mutual exclusion algorithm for N≥2 processes, by exhaustive model checking. Although the approach, as already confirmed by similar experiments reported in the literature, is not scalable due to state explosion problems, and can be practically applied until N≤5, it is of great value for revealing true properties of analyzed algorithms. For dimensions N>5 the statistical model checker of Uppaal can be used which, although based on simulations, can confirm properties by estimations and probabilities. The paper describes the proposed modelling and verification method and applies it to several mutual exclusion algorithms, thus retrieving known properties but also showing new results about properties often studied only by peer-review and intuitive reasoning.

The process of sexual reproduction in eukaryotes starts when gametes from two different sexes encounter each other. Paramecium, a unicellular eukaryote, undergoes conjugation and uses a gametic nucleus to enter the sexual reproductive process. The molecules responsible for recognizing mating partners, hypothetically called mating-type substances, are still unclear. We have identified an O3-type mating substance polypeptide and its gene sequence using protein chemistry, molecular genetics, immunofluorescence, RNA inter-ference, and microinjection. The O3-type substance is a polypeptide found in the ciliary membranes, located from the head to the ventral side of cells. The O3-type substance has a kinase-like domain in its N-terminal part located outside the cell and four EF-hand motifs that bind calcium ions in its C-terminal part located inside the cell. RNA interference and immunofluorescence revealed that this polypeptide positively correlated with the expression of mating reactivity. Microinjection of an expression vector incorporating the O3Pc-MSP gene induced additional O3 mating type in the recipient clones of different mating types or syngen. Phylogenetic analysis indicates this gene is widely present in eukaryotes and exhibits high homology among closely related species. The O3Pc-MSP gene had nine silent mutations compared to the complementary mating type of the E3 homologue gene.

Drug resistance in tumor cells is a significant roadblock in the clinical management of advanced or recurrent diseases in endometrial cancers. As a part of the tumor-stromal ecosystem, tumor cells are ecologically connected to the cancer-associated fibroblasts (CAFs), which form contributory elements of the tumor microenvironment (TME). We recently reported a novel model of patient-derived CAF-based 2-cell Hybrid Co-Culture (HyCC) to evaluate CAFs' role in developing drug resistance and understanding personalized tumor cell-CAF dialogue. Using our 2-cell HyCC model of patient-derived endometrial CAFs, we present data to demonstrate the direct counter-inhibitory effect of CAFs to combinations of cytotoxic and targeted drugs in developing drug resistance. CAFs derived from resected endometrial tumor samples were first passage-wise characterized before and after freeze-thaw for their positive and negative CAF markers expression pattern. Paclitaxel and its combination with copanlisib, TAK228, lenvatinib, and trametinib were used to test the 3D clonogenic growth of endometrial AN3CA cells on endometrial CAFs. We demonstrate that CAF-mediated resistance to antitumor drugs occurs via direct and indirect contact with CAFs in HyCC. Our data established the strength of the 2-cell HyCC model of patient-derived CAFs in solid tumors and provided a model of resistance to antitumor drugs tailored on a patient-to-patient basis.

Abstract: The surge of diabetes poses a significant global health challenge, particularly in Oman and the Middle East. Early detection of diabetes is crucial for proactive intervention and improved patient outcomes. This research leverages the power of machine learning, specifically, Convolutional Neural Networks (CNNs), to develop an innovative 4D CNN model dedicated to early diabetes prediction. A region-specific dataset from Oman is utilized to enhance health outcomes for individuals at risk of developing diabetes. The proposed model showcases remarkable accuracy, achieving an average accuracy of 98.49% to 99.17% across various epochs. Additionally, it demonstrates excellent F1 score, recall, and sensitivity, highlighting its ability to identify true positive cases. The findings contribute to the ongoing effort to combat diabetes and pave the way for future research in using deep learning for early disease detection and proactive healthcare.

Trypanosoma cruzi infection results in debilitating cardiomyopathy, which is a major cause of mortality and morbidity in the endemic regions of Chagas disease (CD). The pathogenesis of Chagasic cardiomyopathy (CCM) has been intensely studied as a chronic inflammatory disease until recent observations reporting the role of cardio-metabolic dysfunctions. In particular, we demonstrated accumulation of lipid droplets and impaired cardiac lipid metabolism in the hearts of cardiomyopathic mice and patients, and their association with impaired mitochondrial functions and endoplasmic reticulum (ER) stress in CD mice. In the present study, we examined whether treating infected mice with an ER stress inhibitor can modify the pathogenesis of cardiomyopathy during chronic stages of infection. T. cruzi infected mice were treated with an ER stress inhibitor 2-Aminopurine (2AP) during the indeterminate stage and evaluated for cardiac pathophysiology during the subsequent chronic stage. Our study demonstrates that inhibition of ER stress improves cardiac pathology caused by T. cruzi infection by reducing ER stress and downstream signaling of phosphorylated eukaryotic initiation factor (P-elF2α) in the hearts of chronically infected mice. Importantly, cardiac ultrasound imaging showed amelioration of ventricular enlargement, suggesting that inhibition of ER stress may be a valuable strategy to combat the progression of cardiomyopathy in Chagas patients.

With the fintech industry growing at an unprecedented rate, it is critical to protect cybersecurity and ensure data privacy. The research presented here offers a thorough examination of the challenges faced by financial technology companies, highlighting the growing risks posed by malware, phishing, and network vulnerabilities. As essential components of a proactive defense plan, the report promotes strong cybersecurity measures like frequent security assessments, encryption, and stringent access controls. The findings highlight how important it is for fintech companies to give cybersecurity equal importance with open and honest data privacy policies in order to win over customers. In order to protect the industry from cybersecurity risks regulatory compliance, intrusion detection systems, and collaborative information sharing are considered essential components. The article advises businesses to include cybersecurity and data privacy into their core business operations and customer relations, highlighting the critical role these factors play in sustaining success in the rapidly evolving fintech industry.

In this paper the possibility of harvesting energy from the vibrations of a plate is analyzed. The harvester takes the form of a cantilever dynamic vibration absorber equipped with a piezoelectric layer and tuned by means of a tip mass to the first mode of vibration of the plate. A mathematical model of the coupled system composed of the plate and the harvester is presented. The validity of the proposed harvester is proved by means of simulations carried out with the modal expansions approach. Simulation results highlighting the effect of harvester tuning and location are presented as well. Then the validity of the harvester is confirmed by experimental tests carried out both with a concentrated impulsive load and with a distributed pressure load. Simulations and experimental tests show that the cantilever piezoelectric dynamic vibration absorber generates open circuit voltage an order of magnitude larger than the one generated by the same piezoelectric layer when directly bonded to the plate surface.

With the deterioration of the bridge performance and ever-increasing amount of traffic, the bridge safety is becoming a concern for engineering community. A method that can assess the bridge's condition in real-time is urgently needed. The main factors that hinder the bridge condition assessment are the uncertain operational environments. A new moving principal component analysis (MPCA) based method is developed for structural damage detection of bridges in operational environments in this paper. Two main operational environmental factors: the environmental temperature and traffic loads, are studied in the assessment process to verify the robustness and practicality of the proposed method. The numerical and experimental results show that the proposed method is effective and accurate to assess the bridge condition in operational environments.

During the last years the desire and the need for green buildings have been increased. The rise of energy cost, the higher transportation expenses and the international challenges along with the climate change are related with the green buildings market but are also affecting the cost of construction. The aim of this research is to discover and confirm the increased request of green properties and to investigate whether this is related to a new need or just a desire of the buyers. Moreover, the paper examines the people’s knowledge of greenness and sustainability and their wish to live and work in sustainable buildings. Finally, do the buyers will to pay extra in order to purchase a sustainable property and how sustainability can affect the market value and the construction industry. The participants who took part in this research were people that are living and working in Cyprus. One of the significant outcomes was the fact that people who have the knowledge and awareness related to sustainability are willing to pay extra to purchase green properties.

During the last 20 years, with the development of Information and Communication Technologies (ICTs), an emerging interest has appeared in Digital Community Engagement (DCE) in the process of cultural heritage management. Due to a growing need to involve a broader community in the Historic Urban Landscape approach, social media are considered one of the most important platforms to promote the public participation process of urban heritage conservation in the context of rapid urbanization. Despite the growing literature on DCE, which has delivered a general overview of different digital technologies and platforms to enhance heritage conservation, little research has been done on taking stock of the utilization of social media in this process. This study aims to fill the research gap by providing a more comprehensive picture of the functionalities of social media platforms and impacts on sustainable urban development through a systematic literature review. As a result, 19 out of 248 DCE relevant articles are selected as objects to illustrate the contribution of social media. The study identified the characteristics of these applied social media tools, explores their roles and influences in cases. The article concludes with directions for further research.

Iron metabolism plays a crucial role in the management of hemoglobinopathies, particularly in conditions such as β-thalassemia and sickle cell anemia (SCA). This paper describes the mechanisms of iron overload in patients with transfusion-dependent thalassemia (TDT), non-transfusion-dependent thalassemia (NTDT), and SCA, highlighting the distinct paths leading to iron accumulation in each condition. The primary focus of this review article is on the role of genetic modifiers influencing iron metabolism and the variability in iron overload presentation among patients. Genetic mutations in genes such as HFE, HAMP, TFR2, SLC40A1, and others significantly impact iron regulation. These modifiers can exacerbate or ameliorate iron overload, and understanding these genetic factors is important for explaining the diverse disease severity and differences in the mechanism and clinical presentation of iron overload in these patients. The ongoing INHERENT study aims to further elucidate the influence of these genetic modifiers through a comprehensive genome-wide association study, potentially leading to novel therapeutic interventions for managing iron homeostasis in hemoglobinopathy patients.

In 2011, commercial aviation contributed approximately 3.5% of global anthropogenic climate change through the emission of greenhouse gases during flight and operational non-CO2 climate effects. Over the last few years, numerous aviation-related organisations have set goals to reduce aviation’s climate impact. These goals, however, lack alignment, are poorly or ambiguously defined, or are internally inconsistent. This increases uncertainty about what aviation should work towards, how various stakeholders can contribute, and introduces problems with respect to accountability. In order to address this issue, this paper presents a comprehensive definition of a climate neutral air transport system as an “air transport system of which the climate effects of all its greenhouse gases and non-carbon dioxide effects throughout the entire life-cycle of each element of the system is balanced”. The proposed definition spans relevant system and encompasses all life cycle phases. To achieve a climate neutral air transport system by 2050, all life-cycle greenhouse gas emissions and non-CO2 climate effects remaining after in-sector reduction should be neutralised, as should all remaining non-CO2 climate forcing from emissions prior to 2050. Clarity on governance is furthermore needed, as the goal and associated targets proposed should be adopted globally.

In this study, a novel absorbable hemostatic agent was developed using carrageenan (CRG) as a natural polymer and cerium oxide nanoparticles (CeO2 NPs).  CRG-CeO2-0.5 and CRG-CeO2-1 composites were prepared by compositing CRG and CeO2 at a weight ratio of 200:1 and 100:1, respectively. Physio-chemical and structural properties of these compounds were studied and compared with pristine CRG. Upon incorporation of CeO2 nanoparticles into the CRG matrix, significant reductions in hydrogel degradation were observed. In addition, it was noted that CRG-CeO2 exhibited better antibacterial and hemostatic properties than CRG hydrogel without CeO2.The biocompatibility of the materials was tested using the NIH 3T3 cell line and all samples were found to be nontoxic. Particularly, CRG-CeO2-1 demonstrated superior hemostatic effects, biocompatibility, and a lower degradation rate since more CeO2 Nps were present in the CRG matrix. Therefore, CRG-CeO2-1 has the potential to be used as a hemostatic agent and wound dressing.

Abstract: The study focuses on how socio-economic and demographic indicators affect fertilization sustainability (excessive amount of fertilization). Principally we aim to examine the significance magnitude of the effects of three socio-demographic variables such as traditional way of fertilization, rental land farming, and farmers’ younger age on over-fertilization in Bangladesh and other developing countries. In 1960s, Bangladesh state authority launched a campaign ‘Grow more Food’ to feed huge numbers of population and thus the farmers are provided chemical fertilizers and pesticides at a subsidized low price. Farmers began to use huge amount of fertilizers for gaining high yields and continued it to present causing environmental woes a lot. We interview (face-to-face, focus group discussion, and phone interview) 210 Bangladesh farmers in 2016 by semi-structured questionnaire. Data has been analyzed using General Linear Model (GLM) in Univariate Analysis of Variance. The study found the effect of traditional way of fertilization on excessive amount of fertilization is strongly significant at 1% level. Apart from, rental land farming and farmers’ younger age have a significant influence on over- fertilization; though their significance level (5% and 10% respectively) is quasi-strong. Policy makers can be able to formulate fertilizer policy on the basis of these findings.

The vomeronasal system serves as a pivotal element in mammalian sensory biology, allowing the perception of chemical signals essential for social communication via the activation of two main receptor families, V1R and V2R. The expression of V1Rs and V2Rs is linked with that of the G-protein alpha-subunits, Gαi2 and Gαo, respectively. The exploration of the evolutionary pathways of V1Rs and V2Rs across all mammalian species remains a main challenge, juxtaposing available genomic data against emerging immunohistochemical evidence. However, recent investigations, in contrast to what is predicted by the currently annotated genomic sequences, have revealed the expression of Gαo in the vomeronasal neuroepithelium of wild canids, including wolves and foxes. In the present study, the employment of a specific antibody raised against the mouse V2R2, member of the C-family of vomeronasal receptors, V2Rs, has confirmed the expression of this receptor in the fox and wolf, but it has revealed the lack of expression in the dog. This may reflect the impact of domestication on the regression of the VNS in this species, in contrast to their wild counterparts, and underscores the effects of artificial selection on sensory functions. Thus, these findings suggest a more refined chemical detection capability in wild species.

Abstract Introduction PCa is one of the cancers that exhibits the widest disparity gaps. Geographical place of residence has been shown to be associated with healthcare access/utilization and PCa outcomes. Geographical Information Systems (GIS) are widely being utilized for PCa disparities research, however, inconsistencies in their application exist. This systematic review will summarize GIS application within PCa disparities research, highlight gaps in the literature and propose alternative approaches. Methods This paper followed the methods of the Cochrane Collaboration and the criteria set of the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA). Articles published in peer-reviewed journals were searched through the PubMed, Embase, and Web of Science databases till December 2022. The main inclusion criteria were employing a GIS approach and examining a relationship between geographical components and PCa disparities. The main exclusion criteria were studies conducted outside the US and those that were not published in English. Results A total of 25 articles were included, 23 focused on PCa measures as outcomes: incidence, survival, and mortality while only two examined PCa management. GIS application in PCa disparities research was grouped into three main categories: mapping, processing, and analysis. GIS mapping allowed for the visualization of quantitative, qualitative, and temporal trends of PCa factors. GIS processing was mainly used for geocoding and smoothing of PCa rates. GIS analysis mainly served to evaluate global spatial autocorrelation and distribution of PCa cases, while local cluster identification techniques were mainly employed to identify locations with poorer PCa outcomes, soliciting public health interventions. Discussion Varied GIS applications and methodologies have been used in researching PCa disparities. Multiple geographical scales were adopted leading to variation in associations and outcomes. Geocoding quality varied considerably leading to less robust findings. Limitations in cluster-detection approaches were identified especially when variations were captured using the Spatial Scan Statistic. GIS approaches utilized in other diseases might be applied within PCa disparities research for more accurate inferences. A novel approach for GIS research in PCa disparities could be focusing more on geospatial disparities in procedure utilization especially when it comes to PCa screening techniques. Conclusion This systematic review summarized and described the current state and trend of GIS application in PCa disparities research. Although GIS is of crucial importance when it comes to PCa disparities research, future studies should rely on more robust GIS techniques, carefully select the geographical scale studied, and partner with GIS scientists for more accurate inferences. Such interdisciplinary approaches have the potential to bridge the gaps between GIS and cancer prevention and control to further advance cancer equity.

A rare genetic disorder caused by col18.a1 mutations, inherited mostly in autosomal recessive and rarely in autosomal dominant pattern, giving rise to ocular abnormalities and other associated disorders, the condition is referred to as Knobloch syndrome. This paper overviews the anterior and posterior ocular symptoms in Knobloch patients, thus demonstrating the major findings in Knobloch cases including the mutational analysis which discusses the proteins involved and exon number on which mutations are detected. Animal modeling done by knocking out col18.a1 has also been discussed to determine the functions of this gene which have been identified based on anomalies found in knock-out mice.

The effects of post-treatment temperature-based methods on 1D single PLA filaments after FFF have been studied. This lets to decouple the variables related to the 3D structure (layer height, raster angle, infill density, and others) from the variables solely related to the material (molecular weight, molecular orientation, crystallinity, and others). PLA 1D filaments have been aged at 20, 39, 42, 51, 65, 75 and 80 ºC in a water-bath-inspired process in which the hydrolytic degradation of the PLA has been minimised for the ageing temperatures of interest. The evolution of the thermal and mechanical properties of the PLA filaments at different temperatures was recorded. Differential scanning calorimetry (DSC) was used to evaluate thermal and physical properties, in which the glass transition, enthalpic relaxation, crystallisation and melting reactions were analysed. Tensile tests were performed to evaluate the tensile strength and elastic modulus. The flow-induced molecular orientation, the degradation, the logistic fitting and the so-called summer effect –stabilisation of properties at higher temperatures– are discussed for assessing the safeness of accelerating ageing.

Fungal infections impact the lives of at least 12 million people every year, killing over 1.5 million. Wide-spread use of fungicides and prophylactic antifungal therapy have driven resistance in many serious fungal pathogens, and there is an urgent need to expand the current antifungal ar-senal. Recent research has focused on improving azoles, our most successful class of antifungals, by looking for synergistic interactions with secondary compounds. Synergists can co-operate with azoles by targeting steps in related pathways, or they may act on mechanisms related to re-sistance like active efflux or on totally disparate pathways or processes. A variety of sources of potential synergists have been explored, including pre-existing antimicrobials, pharmaceuticals approved for other uses, bioactive natural compounds and phytochemicals, and novel synthetic compounds. Synergy can successfully widen the antifungal spectrum, decrease inhibitory dosag-es, reduce toxicity, and prevent the development of resistance. This review highlights the diversity of mechanisms that have been exploited for the purposes of azole synergy and demonstrates that synergy remains a promising approach for meeting the urgent need for novel antifungal strate-gies.

Abstract:Global ship demolition is mostly concentrated in south Asian countries, namely Bangladesh, India, Pakistan and China, since 1990’s, having competitive advantage for their high natural tide, and low environmental and social costs. Due to high social and environmental externalities, stakeholders increase monitoring of the externalities and continue to prescribe improvement towards sustainability, which put pressures on profitability and competitiveness. As a consequence, also seen in the past, a leakage effect may emerge, leading to shift of this activity to a region, with relatively less monitored and less stricter on social and environmental impacts. Unfortunately, the leakage effect is never predicted in shipbreaking in order to understand the level of push compatible in the given socio-economic contexts. In this study, we have attempted to predict the future ship demolition landscape, applying machine learning technique to 34,531 in-service vessels worldwide, larger than 500 gross tonnage (GT), which is run against a learning model based on 3500 demolished vessels from 2014. This study shows that redistribution may occur among the top recycling nations: India may emerge out to be a dominant player in shipbreaking, surpassing Bangladesh by a margin of two-fold, while Pakistan and China are in decreasing trend. In addition, the leakage effect is observed, in that Vietnam is predicted to be the fourth largest ship demolition country, while China and Pakistan recede from the third and fourth place to 6th and 8th. Turkey is predicted to advance from fifth position to third position by vessel count but stays same in term of total GT dismantled. Although it is not clear if any leakage is to be observed in the near future, this study may be a model for future predictive analytics and help stakeholders take evidence-based business decisions.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

Elevated levels of histamine cause the secretion of gastric hydrochloric acid (HCl), leading to gastrointestinal (GI) disorders and anxiety. While aberrant levels of histamine mediate neuroinflammation, pathogenic alterations in the hippocampus of the brain have been linked to anxiety. Eventually, antihistamine drugs that are used against GI disorders appear to be anxiolytic agents. Ranitidine is a widely used antihistamine drug to manage GI disorders as it works by blocking the histamine (H)-2 receptors in oxyntic cells thereby, reducing the HCl production in the stomach. Though some reports indicate the neuroprotective effects of ranitidine, its role against GI disorders related to anxiety remains unclear. Therefore, we investigated the effect of ranitidine against anxiety-related behaviors, neuronal density, and signs of microglia activation in the hippocampal CA3 region of cysteamine HCl-induced mouse model of GI disorder. Results obtained from the open field test (OFT), light and dark box test (LDBT), and elevated plus maze (EPM) revealed that ranitidine treatment reduces anxiety-like behaviors in experimental animals. Nissl staining and immunohistochemical assessment of Iba-1 positive microglia in the cryosectioned brains revealed that the ranitidine treatment enhances the density of pyramidal neurons in association with reduced activation of microglia in the CA3 region of the hippocampus of experimental mice.

Local food has continued to become more popular in both the home and as featured ingredients in all segments of food service. Numerous studies have explored the motivating factors for consumer purchasing motivators. However, no known study has explored if there is a correlation between ego and intent to buy local foods. This study adopted a modified version of the Theory of Trying and surveyed a sample of 237 food service buying agents in South Carolina to examine their perceptions of buying local. Results suggest that ego is a predictor of trying to purchase local foods for restaurants. It was also found that the modified model is an acceptable model for predicting buyer intent. These findings support the majority of the studies looking at ego-centric behaviors with green purchases and could potentially help local food suppliers to better market their products to foodservice establishments. This study could also act as the foundation for future studies to explore the full extent of ego’s motivational effect on purchasing intentions in the food service industry.

Abstract Sickle cell anaemia (SCD) is a life-threatening haematological disorder which is predominant in sub-Saharan Africa and is triggered by a genetic mutation of the β-chain haemoglobin gene resulting in the substitution of glutamic acid with valine. This mutation leads to the production of an abnormal haemoglobin molecule called haemoglobin S (HbS). When deoxygenated, haemoglobin S (HbS) polymerizes and results in a sickle-shaped red blood cell which is rigid and has a significantly shortened life span. Various reports have shown a strong link between oxidative stress, inflammation, the immune response, and the pathogenesis of sickle cell disease. The consequence of these processes lead to the development of vasculopathy (disease of the blood vessels) and several other complications. The role of the immune system, particularly the innate immune system, in the pathogenesis of SCD has become increasingly clear in recent years of research, However, little is known about the roles of the adaptive immune system in this disease. This review examines the interaction between the immune system, inflammation, oxidative stress, blood transfusion, and their effects on the pathogenesis of sickle cell anaemia

Optical properties of the cornea are responsible for correct vision, ultrastructure allows optical transparency and biomechanical properties governs the shape, elasticity or stiffness of the cor-nea affecting ocular integrity and intraocular pressure. Therefore, optical aberrations, corneal transparency, structure and biomechanics play a fundamental role in the optical quality of hu-man vision, ocular health and refractive surgery outcomes. However, the convergence of those properties is not yet reported at macroscopic scale within the hierarchical structure of the cornea. This work explores the relationships between biomechanics, structure and optical properties (corneal aberrations and optical density) at macrostructural level of the cornea through dual Placido-Scheimpflug imaging and air-puff tonometry systems in a healthy young adult popula-tion. Results showed convergence between optical transparency, corneal macrostructure and biomechanics.

Background: Histone deacetylases (HDACs) are implicated in carcinogenesis, and HDAC inhibitors (HDACis) are explored as a therapeutic tool in several tumors. The aim of this study was to evaluate the clinical significance of HDAC -2, -4, and -5 expression in epithelial ovarian carcinoma (EOC). Methods: HDAC-2, -4, and -5 immunohistochemical expression was examined in 92 EOC tissue specimens and was correlated with clinicopathological characteristics. Results: HDAC-2 was the most frequently (94.4%) expressed isoform, being marginally higher in serous tumors compared with other types (p=0,08). HDAC-5 was the less frequently expressed (28.1%), being positively associated with HDAC-4. HDAC-4 positivity was associated with lower FIGO-stage (p=0,045) and T-category (p=0.,043) and the absence of lymph node (p=0,05) or distant metastasis (p=0,09) in serous carcinomas. HDAC-2 positivity was correlated with absence of lymph node metastasis in serous tumors (p=0,045). On the contrary, HDAC-5 nuclear positivity was correlated with lymph node metastasis in the entire cohort (p=0,048). HDAC-4 positivity was marginally associated with favorable prognosis in serous carcinomas in univariate survival analysis (p=0,086), a correlation which was not significant in multivariate analysis. Conclusion: These findings suggest a differential expression of HDAC-2, -4 and -5, providing evidence for a potential role in the pathobiology of EOC.

Abstract: Short-chain fatty acids (SCFAs) are the major microbial metabolites produced in the gut through the fermentation of non-digestible fibers. SCFAs act through free fatty acid receptor 2 and 3 (FFAR2 and 3), which are known to be expressed on glucagon-like peptide-1 (GLP-1)-secreting L-cells. This pathway is suggested to protect the intestinal mucosa. We aimed to investigate how lack of fiber affects the production of SCFAs and the vulnerability of the co-lon. Additionally, the involvement of FFAR2 and 3 in GLP-1 secretion and intestinal protection. SCFA concentrations in luminal contents from chow- or fiber-free diet-fed mice were analysed by LC‒MS. SCFAs were applied to isolated perfused colons from FFAR2/3 double KO and WT mice, and the secretion of GLP-1 was measured. Dextran sulfate sodium (DSS) colitis was induced in chow- or fiber-free diet-fed mice as well as in FFAR2/3 KO and WT mice. The removal of die-tary fiber significantly decreased total colonic SCFA concentrations, with specific decreases in acetate, propionate, and butyrate. SCFAs significantly increased colonic GLP-1 secretion but not in FFAR2/3 KO mice. In the DSS model, the removal of dietary fiber increased the severity and delayed recovery. Colitis severity was independent of FFAR2 and FFAR3 signaling.

Measurement of Globe temperature is essential for investigating thermal comfort in street canyon. Globe thermometer is the most common instrument used to measure globe temperature (GT), however its application in scale models is still uncertain and not thoroughly investigated as of today. Therefore, this study is explicitly conducted to investigate globe thermometer measurements and proposed an improvised customization of the globe thermometer size to enhance reliability in scale models. The experiments were carried out outdoors using a typical street canyon model (scale 1:100) with East-West street orientation. The experiment presented a comparison between a low solar reflective street canyon (albedo of 0.4) and a high solar reflective canyon (albedo of 0.6) in terms of surface temperatures, heat flux and globe temperature. Furthermore, this study also investigated the influence of solar orientation on the globe temperature using both experimental using scale models and microclimatic modelling using ENVI-met. It is observed that although the surface temperatures are lower with high solar reflective canyon compared to that with low solar reflective canyon, GT is higher in high reflective canyon during daytime, which could be due to combined effect of direct radiation and shortwave reflection. However, for hours after the sun set, GT becomes lower (up to 1°C) in the case of high reflective canyon compared to low reflective canyon.

This paper reports aligned activities to promote energy and resource-efficient construction practice in Vietnam. First, the governance framework is introduced, including government decrees and technical standards. Then, a laboratory with building physics measurement technology is designed and partly set up at the local partner Vietnam Institute for Building Materials (VIBM), which can be used to determine the essential characteristic values required for the implementation of energy standards. The basis for the prioritization of the characteristic values are the requirements of the National technical regulation on energy efficient buildings of Vietnam – QCVN09:2017/BXD. Furthermore, basic characteristic values from international standards are described, which can also be used for calculations to optimize the energy consumption of buildings. In order to be able to carry out transient hygrothermal computer simulations, special characteristic values were also included. These are particularly useful for the research and development of new building materials and the evaluation of entire buildings in terms of thermal and moisture protection In order to communicate the material properties to the market and enable informed decision making by the stakeholders, a labeling system has been developed. Thereby, the practical means for implementing governance instruments are provided, and the related technical applications are supported.

The first exposure to influenza is thought to impact subsequent immune responses later in life. The consequences of this can be seen during influenza epidemics and pandemics with differences in morbidity and mortality for different birth cohorts. There is a need for better understanding of how vaccine responses are affected by early exposures to influenza viruses. In this analysis of hemagglutination inhibition (HI) antibody responses in two cohorts of military personnel we noticed differences related to age, sex, prior vaccination, deployment and birth year. These data suggest that HI antibody production, in response to influenza vaccination, is affected by these factors. The magnitude of this antibody response is associated with, among other factors, the influenza strain that circulated following birth.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

ESG (Environmental, Social, and Governance) responsibility fulfillment increasingly affects enterprise valuation. Although researchers debate about the precise effects, the prevailing view suggests a linear relationship between ESG performance and enterprise value. This study introduces a novel ESG responsibility performance metric through the Regulated Intermediary Model to delve into this relationship within the Chinese context. Our findings reveal an inverted U-shaped relationship between ESG performance and enterprise value, with financing constraints having a significant moderating effect. These findings remain robust after employing instrumental variables to mitigate potential endogeneity. Heterogeneity analysis demonstrates that this inverted U-shaped relationship is particularly pronounced in non-polluting and non-state-owned enterprises. Moreover, a comparison between equity and debt financing mechanisms underscores that improved ESG performance is associated with lower cost of equity financing, thereby enhancing enterprise value. Financial institutions are encouraged to leverage innovative financial instruments to diversify enterprise financing channels and alleviate financing constraints of enterprises that fulfill their ESG responsibilities.

The Chikungunya virus (CHIKV) poses a significant global public health concern, especially in Africa. Since its first isolation in Tanzania in 1953, CHIKV has caused recurrent outbreaks, challenging healthcare systems in low-resource settings. Recent outbreaks in Africa highlight the dynamic nature of CHIKV transmission and the challenges of underreporting and underdiagnosis. Here, we review literature and analyze publicly available cases, outbreaks, and genomic data providing insights into the epidemiology, genetic diversity, and transmission dynamics of CHIKV in Africa. Our analyses reveal the circulation of geographically distinct CHIKV genotypes, with certain regions experiencing a disproportionate burden of disease. Phylogenetic analysis of sporadic outbreaks in West Africa suggests repeated emergence of the virus through enzootic spillover, which is markedly different from inferred transmission dynamics in East Africa, where the virus is often introduced from Asian outbreaks, including the recent reintroduction of the Indian Ocean lineage from the Indian subcontinent to east Africa. Furthermore, there is limited evidence of viral movement between these two regions. Understanding the history and transmission dynamics of outbreaks is crucial for public health planning. Despite advances in surveillance and research, diagnostic and surveillance challenges persist. This review and secondary analysis highlight the importance of ongoing surveillance, research, and collaboration to mitigate the burden of CHIKV in Africa and improve public health outcomes.

Background: To compare the clinical efficacy of Japas osteotomy of the middle foot and first metatarsal sequence osteotomy in treating children with cavovarus foot deformity. Methods: A retrospective analysis was performed on the clinical effect of cavovarus foot surgery from January 2012 to January 2019. Thirty light and medium cavovarus foot cases underwent osteotomy based on soft tissue release. Among them, 16 cases of 22 feet underwent first metatarsal sequence osteotomy, and 14 cases of 21 feet underwent middle foot Japas osteotomy. Ankle-posterior foot (Wicart) scoring system was used to evaluate the good and good rates of the two surgical methods. X-ray films were taken before and after the last follow-up in a standing weight-bearing position, and Meary Angle, Hibb Angle, and Pitch Angle were measured to compare the clinical efficacy of the two surgical methods in correcting the light and medium-cavovarus foot deformity.Results: (1) All patients were followed up for an average of 30 months. There was no significant difference in Meary, Hibb, and Pitch Angle between first metatarsal osteotomy and middle foot Japas osteotomy before surgery, indicating that the severity of malformation was similar between the two groups. (2) The Meary, Hibb, and Pitch Angle of the last follow-up were compared between the two groups (P>0.05), which showed no statistical significance, indicating that the two surgical methods had similar effects on cavovarus deformity correction. (3) At the most recent follow-up, there was no statistically significant difference between the two groups regarding the percentage of patients who achieved an excellent or good Wicart score; for the first metatarsal osteotomy group, the rate was 87%, and for the Japas osteotomy group was 90%; the Fisher test p>0.05 indicates that the postoperative excellent and good rates of the two treatments are comparable.II (4) Comparison of operation time and intraoperative blood loss between the two groups, P<0.05, showed statistically significant differences, indicating that the first metatarsal osteotomy had obvious advantages over Japas osteotomy operation time and intraoperative blood loss. Conclusions: There is no significant difference in postoperative efficacy between first metatarsal osteotomy and Japas osteotomy for light and medium-cavovarus with the apex of the deformity located at the medial cuneus or navicular cuneiform joint. However, the intraoperative blood loss and operative time of first metatarsal osteotomy are superior to Japas osteotomy of the middle foot, and the trauma to children is less. Therefore, the first metatarsal osteotomy can be considered a surgical procedure.

Silicon Photomultipliers find applications across various fields. One potential Silicon Photomultiplier application domain is neutrino telescopes, where they may enhance the angular resolution. However, the elevated dark count rate associated with Silicon Photomultipliers represents a significant challenge to their widespread utilization. To address this issue, it is proposed to use Silicon Photomultipliers and Photomultiplier Tubes together. The Photomultiplier Tubes signals would serve as a trigger to mitigate the dark count rate, thereby preventing undue saturation of the available bandwidth. This paper presents an investigation into a fast and resource-efficient method for filtering Silicon Photomultiplier dark count rate. A low-resource and fast coincident filter has been developed, which removes the Silicon Photomultiplier dark count rate by using as trigger the Photomultiplier Tube input signals. The architecture of the coincidence filter, together with the first results obtained, which validate the effectiveness of this method are presented.

Beneficial microbes are crucial for improving crop adaptation and growth under vari-ous stresses. They enhance nutrient uptake, improve plant immune responses, and help plants tolerate stresses like drought, salinity, and heat. The yield potential of any crop is significantly influenced by its associated microbiomes and their potential to im-prove growth under different stressful environments. Therefore, it’s crucial and excit-ing to understand the mechanisms of plant-microbe interactions. Maize (Zea mays L.) is one of the primary staple foods worldwide, in addition to wheat and rice. Maize is also an industrial crop globally, contributing 83% of its production for use in feed, starch, and biofuel industries. Maize requires significant nitrogen fertilization to achieve opti-mal growth and yield. Maize plants are highly susceptible to heat, salinity, and drought stresses and require innovative methods to mitigate the harmful effects of environmental stresses and reduce the use of chemical fertilizers. This review summarizes our current understanding of the beneficial interactions between maize plants and specific microbes. These beneficial microbes improve plant resilience to stress and in-crease productivity. For example, they regulate electron transport, downregulate cata-ase, and upregulate antioxidants. We also review the roles of plant growth promoting rhizobacteria (PGPR) enhancing stress tolerance in maize. Additionally, we explore the application of these microbes in maize production and identify major knowledge gaps that need to be addressed to utilize the potential of beneficial microbes fully.

Most existing coal-fired power plants were designed for sustained operation at full load to maximize efficiency, reliability, and revenue, as well as to operate air pollution control devices at design conditions. Depending on plant type and design, these plants can adjust output within a fixed range in response to the plant operating or market conditions. The need for flexibility driven by increased penetration of variable and non-dispatchable power generation such as wind and solar is shifting the traditional mission profile of thermoelectric power plants in three ways: more frequent shutdowns when market or grid conditions warrant, more aggressive load ramp rates (rate of output change), and lower minimum sustainable load, which provides a wider operating range and helps avoid costly plant shutdowns. Recent studies have shown that flexibility of a coal-fired power plant can be improved by energy storage. The objective of this work was to analyze a set of energy storage options and determine their impact on flexibility and economics of a representative coal-fired power plant. The effect of three energy storage systems integrated with a coal power plant on plant flexibility and economics was investigated. The results obtained in this project show that Energy Storage Systems integrated with a thermal power plant improves plant flexibility and participation in the Energy and Ancillary Services markets which improves plant financial performance. The study was funded by the U.S. Department Office of Fossil Energy FE-1 under Award Number DE-FE0031903.

Land plants have undergone their great diversification and evolution in the past 400 million years. Although appearing complex and hard to grasp, the evolution of plants centers around an invariable core development process, SRC (Sexual Reproductive Cycle). Various modifications have been added sequentially to this core process, and thus creating various novel organs and distinguishing their bearers one from another. Reproductive organs of all land plants, including sporangium, megasporangium, metamegasporangium (= ovule), and various metamegasporangium complexes, are derived from terminal sporangia in the earliest land plants. Throughout the million-year-long evolution, plants sequentially recruit associating accessories to protect their vulnerable core parts (spore and gamete). The occurrence of every single of these novelties is a stair marking land plant reproduction evolution and leads to enhanced offspring development conditioning (ODC).

The results of the most recent investigation of triterpenoid-based antiviral agents effective namely in the HIV-1 and HSV-1 treatment were reviewed and summarized. Several key historical achievements are included to stress consequences and continuity in this research. Most of the agents studied belong into a series of compound derived from betulin or betulinic acid, and their synthetic derivative called bevirimat. A termination of clinical trials of bevirimat in the Phase IIb initiated a search for more successful compounds partly derived from bevirimat or designed independently of bevirimat structure. Surprisingly, a majority of bevirimat mimics are derivatives of betulinic acid, while other plant triterpenoids, such as ursolic acid, oleanolic acid, glycyrrhetinic acid or other miscellaneous triterpenoids, are relatively rarely involved in a search for novel antiviral agent. Therefore, this review article is divided into three parts based on the leading triterpenoid core structure.

Nutrients are the driving force of plant and herbivore interactions. Different elements and fertilization levels in soil, or artificially fertilized substrates can have a direct impact on plant defense responses. Meanwhile, nutrient levels mediated by root associated microbes can indirectly affect plant-herbivore interactions. Nutrient uptake promoted by beneficial mycorrhizal fungi or rhizobacteria interacting with roots can stimulate plant tolerance to herbivore attack, as evidenced by herbivore performance, plant nutrient status, plant biomass allocation and compensatory growth. In return, herbivory affects nutrient fluxes between plants and their associated beneficial microbes. Furthermore, aboveground and belowground herbivory can affect the nutrient exchange between plants and soil microbial communities, mainly for carbon-and nitrogen-based resources supporting herbivores´ life cycles. These ecological interactions are governed by jasmonic acid (JA) and key enzymes on the molecular level. This review summarizes the current scientific literature on the role of nutrients in plant-herbivore interactions. This will support efforts to optimize plant defense strategy via managing nutrient variance.

In sustainable agriculture, plant nutrients are the most important elements. Biofertilizers introduce microorganisms that improve the soil nutrients and increase their accessibility to crops. In order to meet the demands of a growing population, healthy crops need to be produced using the right type of fertilizers to provide them with all the major nutrients they require. However, an increasing dependency on chemical fertilizers is destroying the environment and negatively af-fecting the health of humans. Thus, using microbes as bioinoculants as the best replacement of chemical fertilizers as eco-friendly way for plant growth and soil fertility is believed to be the best method for improving plant growth and soil fertility. In sustainable agriculture, these microbes provide significant benefits to crops. In addition to colonizing plant systems (epiphytic, endo-phytic, and rhizospheric), beneficial microbes play a key role in absorbing nutrients from surrounding ecosystems. Plant associate microbes can promote plant growth regardless of natural and extreme conditions. Plant growth promoting microbes promote plant growth through a variety of direct and indirect methods, such as nitrogen fixation, plant growth hormone production, siderophores, HCN, several hydrolytic enzymes, and potassium, zinc, and phosphorus solubilization. Research on biofertilizers has been extensive and even available, which demonstrates how these microbes can deliver nutrients to crops in sufficient quantities to enhance their yield. This review examines in detail the direct and indirect mechanisms of PGPR action and their interaction in plant growth and resistance.

To identify soil microbial communities, it is essential to understand their phenotypic and genetic characteristics. Plant growth-promoting rhizobacteria (PGPR) are bacteria capable of promoting plant growth. In addition, rhizobacteria also serve as biological control agents. In addition to fixing atmospheric nitrogen, solubilising insoluble phosphate and secreting hormones such as indoloacetic acid, kinetics and gibberellins, plant growth-promoting rhizobacteria help plants grow directly. Furthermore, they facilitate plant growth indirectly by inducing systemic resistance, siderophores, antibiotics, lytic enzymes, hydrogen cyanide production and stress regulation. This review examines in detail the direct and indirect mechanisms of PGPR action and their interaction in plant growth and resistance.

The climate and its changes are major risk factors for agricultural activities because agricultural systems are highly affected by climatic factors such as temperature, rain, humidity, wind, and solar radiation. While some agricultural areas of the world are irrigated, the vast majority rely on natural rainfall patterns. Farmers will consume more water as a result of climate change and experience less water availability, resulting in a decrease in production capacity. As one of the most important natural phenomena affecting agricultural productivity, drought is a limiting environment for plant growth. The response of plants to water stress is complex and involves coordination between gene expression and its integration with hormones. It has been shown that bacteria have mechanisms to reduce water stress in these plant species and promote greater growth. The underlined mechanism involves root-to-shoot phenotypic changes in growth rate, architecture, hydraulic conductivity, water conservation, plant cell protection, and damage restoration through integrating phytohormones modulation, stress-induced enzymatic apparatus, and metabolites. This review demonstrates how plant growth-promoting bacteria can mitigate negative effects associated with water stress in plants and provide examples of technology conversion in agroecosystems.

Endophytic microbes are a ubiquitous group of plant-associated communities that colonize the intercellular or intracellular host tissues while giving numerous beneficial effects to the plants. All the plant species are thought to be associated with endophytes, majorly constituted with bacteria and fungi. During the last two decades, there has been a considerable movement toward the study of endophytes associated with coffee plants. In this review, the main consideration is given to address the coffee-associated endophytic bacteria and fungi, particularly their action on plant growth promotion and the biocontrol of pests. In addition, we sought to identify and analyze the gaps in available research. Additionally, the potential of endophytes to improve the quality of coffee seeds is briefly discussed. Even though there are limited studies on the subject, it has been well recognized the potentiality of coffee endophytes in plant growth promotion through enhancing nitrogen fixation, availability of minerals, nutrient absorption, secretion of phytohormones, and other bioactive metabolites. Further, the antagonistic effect against various coffee pathogenic bacteria, fungi, nematodes, and also insect pests lead to the protection of the crop. Furthermore, it is recognized that endophytes enhance the sensory characteristics of coffee as a new field of study.

Ursolic and oleanolic acids are secondary plant metabolites that are known to be involved in the plant defence system against water loss and pathogens. Nowadays these triterpenoids are also regarded as potential pharmaceutical compounds and there is mounting experimental data that either purified compounds or triterpenoid-enriched plant extracts exert various beneficial effects, including anti-oxidative, anti-inflammatory and anticancer, on model systems of both human or animal origin. Some of those effects have been linked to the ability of ursolic and oleanolic acids to modulate intracellular antioxidant systems and also inflammation- and cell death-related pathways. Therefore, our aim was to review the current knowledge about the distribution of ursolic and oleanolic acids in plants, bioavailability and pharmacokinetic properties of these triterpenoids and their derivatives, and to discuss their neuromodulatory effects in vitro and in vivo.

The plant productivity-richness relationship (PPR) is one of the most debated and important issues in ecology. There have been distinct stages in the research of this issue, including the discovery of the different PPR shapes, respective tests of influencing processes, and integrative research with vegetation investigation, manipulation experiments, and theoretical analysis. The debate largely focuses on what the dominant shapes and underlying mechanisms are. Recent integrative research works following analyses of respective processes affecting PPR have found that the humped, asymptotic, positive, negative, and irregular shapes of PPR are linked to each other. One shape of PPR may change into another. The balance between positive and negative processes determines the different shapes of PPR. Plant diversity has a globally positive effect on plant productivity.

Plants have evolved tightly regulated strategies to adapt and acclimate to a changing environment to ensure their survival. Various environmental factors affect plant distribution, growth and yield. Low temperature belongs to those abiotic factors which significantly constrain range boundaries of plant species. Exposing plants to low but non-freezing temperature induces a multigenic processes termed cold acclimation, which finally results in an increased freezing tolerance. Cold acclimation comprises reprogramming of the transcriptome, proteome and metabolome and affects communication and signaling between subcellular organelles. Reprogramming of the central carbohydrate metabolism plays a key role in cold acclimation. This review summarizes current knowledge about the role of carbohydrate metabolism in plant cold acclimation. A focus is laid on subcellular metabolic reprogramming, its thermodynamic constraints under low temperature and mathematical modelling of metabolism.