Primary central nervous system and brain tumors are one of the global burdens that are continuously increasing in cases and requiring more treatment options. Surgery has been the leading treatment option for tumors, however, the localization of the tumor and its infiltrating nature make this option challenging. DNA microarray expression profiles of different CNS tumors provide insight into potential biomarkers for identifying different tumor types and subtypes. Here, we utilized the differentially expressed genes common in four expression profiles, GSE66354, GSE68848, GSE74195, and GSE43290 to reconstruct the gene co-expression network. In this study, we were able to identify preserved cluster genes, hub genes, co-regulating transcription factors, miRNA families, and candidate repurposed drugs. Fourteen identified hub genes, which were, CACNA1A, DNM1, GABRA1, GRIA2, MAPT, SLC17A7, SNAP25, SNAP91, STXBP1, SYT1, COL1A1, COL6A2, FBN2, and FN1 appeared to play a role in tumor progression and may serve as drug targets. We also reported the DEGs in each tumor type, which were ATRT, EPN, PA, MED, PNET, MEN, ACM, ODG, and GBM. Five identified miRNA families, which were, let-7 family, mir-124 family, mir-1 family, mir-103 family, and mir-27 family described in the literature to have tumor-suppressing characteristics. Drug-gene and drug-transcription factor network revealed 32 candidate repurposed drugs and 13 were validated through connectivity map analysis. Here, two main repurposed drugs fit the regulatory requirement for gene interaction, these were, quercetin and vorinostat. Future validation in experimental studies may utilize the future use of the candidate repurposed drugs. Our study provides insights into drug repurposing prospects and understanding tumor expressions.

The objective of this work was to analyze the potential of Rhizophora mangle as a bioindicator of seven heavy metals, Fe, Cu, Zn, Mn, Ni, Cr, and Cd, in the mangrove sediments of the Navachiste lagoon complex (NAV). The concentration of trace metals (TM) in sediments and tis-sues (leaf, stembark, and root of R. mangle) were determined by digestion with nitric acid (HNO3), whereas the metal absorbance was measured by atomic absorption spectrophotometry with an air-acetylene flame. The enrichment factor, the bioavailable fraction, the seasonal varia-tion of heavy metal concentrations and their correlation with those determined in R. mangle tissues were assessed. Metal concentrations found in sediments were as following: Fe>Mn>Zn>Cr>Ni>Cu>Cd, and for tissues: Mn>Fe>Zn>Cu>Cr>Ni>Cd, and regarding the roots, the findings were as following: Fe>Mn>Zn>Cu>Cr>Ni>Cd. The highest trace metal concentra-tions were correlated with silt, clay, and organic matter in sediments with basic pH. The highest salinities were found adjacent to R. mangle trees. Of all the trace metals analyzed, there was only a positive linear regression between the bioavailability of Mn in the sediment with the concen-tration of Mn in leaf tissue consistently throughout the year. The Cu bioavailability in the sedi-ment showed similar positive linear regressions except for winter, where it did not show this pattern. These results suggest that the concentrations of Mn and Cu in the R. mangle leaf could be a potential bioindicator of environmental exposure to anthropogenic sources of contamination by these trace metals in sediments

Clinical ketosis is a crucial metabolic disease in dairy cows that is often accompanied by severe lipolysis and inflammation in adipose tissue. Our previous study suggested that the fold change of calmodulin (CaM) was upregulated 2.401-fold in the adipose tissue of cows with clinical ketosis. Therefore, we hypothesize that CaM may regulate lipolysis and inflammatory responses in clinical ketosis cows. To verify the hypothesis, we conducted a thorough veterinary assessment of clinical symptoms and serum β-hydroxybutyrate (BHB) concentration before collecting subcutaneous adipose tissue samples from six healthy and six clinically ketotic Holstein cows at 17 ± 4 days postpartum. Commercial kits were used to test the abundance of BHB, Non-esterified fatty acid (NEFA), Liver function index (LFI), interleukin-6 (IL-6), interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α). We found that Clinical ketosis cows had higher levels of BHB, NEFA, LFI, IL-6, IL-1β, TNF-α, and lower glucose levels compared to healthy cows. Furthermore, the abundance of CaM, toll-like receptor 4 (TLR4), inhibitor of nuclear factor κB kinase subunit β (IKK), phosphorylated nuclear factor κB/nuclear factor κB, (p-NF-κB/NF-κB), adipose triglyceride lipase (ATGL) and phosphorylated hormone-sensitive lipase/hormone-sensitive lipase (p-HSL/HSL) were increased, while that of perilipin-1 (PLIN1) was decreased in the adipose tissue of cows with clinical ketosis. To investigate the mechanistic underlying the responses, we isolated the primary bovine adipocytes from the adipose tissue of healthy cows and induced the inflammatory response mediated by TLR4/IKK/NF-κB with lipopolysaccharide (LPS), in addition to treating with CaM overexpression adenovirus and CaM small interfering RNA. In vitro, LPS upregulated the abundance of CaM, TLR4, IKK, NF-κB, ATGL, p-HSL/HSL, and CaM and downregulated PLIN1. CaM silencing downregulated the abundance of LPS-activated p-HSL/HSL, TLR4, IKK, and NF-κB and upregulated PLIN1 in bovine adipocytes, except for ATGL. By contrast, CaM overexpression upregulated the abundance of LPS-activated p-HSL/HSL, TLR4, IKK, and NF-κB and downregulated PLIN1 expression in bovine adipocytes. In summary, these data suggest that CaM promotes lipolysis in adipocytes through HSL and PINL1 while activating the TLR4/IKK/NF-κB inflammatory pathway to promote an inflammatory response. There is a positive feedback loop between CaM, lipolysis, and inflammation. Overall, inhibiting CaM may act as an adaptive mechanism to alleviate metabolic dysregulation in adipose tissue, contributing to relief from lipolysis and inflammatory response.

The development of potent antiviral agents is of utmost importance to combat the global burden of viral infections. Traditional antiviral drug development involves targeting specific viral proteins, which may lead to the emergence of resistant strains. To explore alternative strategies, we investigated the antiviral potential of antimicrobial peptidomimetic compounds. In this study, we evaluated the antiviral potential of short anthranilamide-based peptidomimetic compounds 1-17 against two viruses: Murine Hepatitis Virus 1 (MHV-1-single stranded RNA virus) which is a surrogate of human coronaviruses and Herpes Simplex Virus 1 (HSV-1-double stranded DNA virus). The half-maximal inhibitory concentration (IC50) values of these compounds were determined in vitro to assess their potency as antiviral agents. Compounds 11 and 14 displayed the most potent inhibitory effect with IC50 values of 2.38μM, and 6.3μM against MHV-1 while compounds 9 and 14 showed IC50 values of 14.8μM and 13μM, against HSV-1. Multiple antiviral assessments and microscopic images obtained through transmission electron microscopy (TEM) collectively demonstrated that these compounds exert a direct influence on the viral envelope. Based on this outcome, it can be concluded that peptidomimetic compounds could offer a new approach for the development of potent antiviral agents.

Helicobacter pylori (H. pylori) is known to play a significant role in the development of peptic ulcer diseases and gastric cancer. Previous studies have reported the existence of polymorphism in the ureC gene of H. pylori. However, the relationship between genetic sequence variations in ureC and the pathogenesis of peptic ulcer diseases remains unclear. We aimed to investigate the associations between ureC sequence variations and the development of gastric ulcer and gastric cancer. PCR amplification and DNA sequencing to analyze ureC sequences, and conducted phylogenetic analysis using MEGA X software. Samples from Taiwanese patients with gastric ulcer and gastric cancer were included in this study. PCR was used to amplify the ureC gene from these samples, followed by DNA sequencing. The obtained sequences were then subjected to phylogenetic analysis using MEGA X software. In addition, ureC sequences from different geographical regions, including China and other countries, were included in the analysis for comparison. Analysis of the ureC se-quences from Taiwanese samples revealed that 6 out of 7 gastric ulcer samples clustered together in one group, while the sequences from 7 out of 8 gastric cancer samples were distributed across other groups. Phylogenetic analysis incorporating ureC sequences from different geographical regions showed that Taiwanese ureC sequences could be divided into two distinct groups, although the bootstrap values supporting this separation were low. Notably, the ureC sequences from China formed a distinct group with a high bootstrap value, separate from sequences from all other countries. There are two genotypes of ureC sequences present in Taiwanese samples, with one genotype showing a closer association with gastric cancer. Additionally, the ureC sequences from China appear to be unique and separate from those obtained from other countries, indicating the presence of genetic diversity in ureC sequences among H. pylori strains from different regions, potentially contributing to differences in disease outcomes. Further research is needed to elucidate the specific mechanisms by which ureC sequence variations may influence the pathogenesis of peptic ulcer diseases and gastric cancer.

The aim was to determine the effect of Sechium edule var. nigrum spinosum (chayote) on gene ex-pression related to antioxidant protection mechanisms and the inflammatory process in older adults with metabolic syndrome (MetS). A quasi-experimental study was carried out in a con-venience sample of 46 older adults diagnosed with MetS: (i) placebo group (PG; n=20), (ii) ex-perimental group (EG; n=26). Clinical, biochemical, and anthropometric parameters, SOD, GPx, and CAT enzyme activity, total oxidant status (TOS), total antioxidant status (TAS), oxidative stress index (OSI), cytokines (IL-6, IL-8 and TNF-α) and mRNA expression of (SOD, GPx, CAT, IL-6, IL-8, TNF-α, Nrf2, NFkB p50 and NFkB p65), were measured at baseline and 6 months post-intervention. A statistically significant decrease was observed in TOS (baseline, 28.9 ± 3.6 vs. post, 23.7 ± 3.4, p < 0.01) and OSI (baseline, 24.1 ± 3.8 vs. post, 17.7 ± 4). As well as the increase in IL-6 (baseline, 10.7 ± 1.1 vs. post, 12.3 ± 2, p = 0.03), SOD activity (baseline, 167.1 ± 11.9 vs. post, 180.6 ± 7.6, p < 0.05), CAT activity (baseline, 1.0 ± 0.2 vs. post, 1.3 ± 0.2, p < 0.01) and TAS (baseline, 1.1 ± 0.1 vs. post, 1.4 ± 0.1, p < 0.01) in the EG compared to the PG. Regarding the expression of Nrf2, SOD and IL-6, the EG showed a significant increase vs basal levels (47%, 44% and 43%, re-spectively). Our findings suggest that Sechium edule supplementation promotes the antioxidant response and decreases oxidative stress via Nrf2.

DNA damage repair lies at the core of all cells’ survival strategy, including cancerous. Therefore, targeting such repair mechanisms forms the major goal of cancer therapeutics. The mechanism of DNA repair has been tousled with the discovery of multiple kinases. Recent studies on Tousled like Kinases have brought significant clarity on the effectors of these kinases which stands to regulate DSB repair. In addition to their well-established role in the DDR and cell cycle checkpoint mediation after DNA damage or inhibitors of replication, their suspected involvement in the actual DSB repair process has more recently been strengthened by the important finding that TLK1 phosphorylates RAD54 and regulates some of its activities and localization in the cell. Earlier findings of its regulation of RAD9 during checkpoint deactivation as well as defined steps during NHEJ ends processing were earlier hints of its important involvement broadly in DSB repair. All this has opened up new avenues to target cancer cells in combination therapy with genotoxins and TLK inhibitors.

Background Multilineage-differentiating stress-enduring (Muse) cells are newly established pluripotent stem cells. The aim of the present study was to examine the potential of the systemic administration of Muse cells as an effective treatment for subacute SCI. Methods: We intravenously administered the clinical product “CL2020” containing Muse cells to a rat model two weeks after mid-thoracic spinal cord contusion. Eight experimental animals received CL2020 and 12 received the vehicle. Behavioral analyses were conducted over 20 weeks. Histological evaluations were performed. After 20 weeks of observation, diphtheria toxin was administered to 3 CL2020-treated animals to selectively ablate human cell functions. Results: Hindlimb motor functions significantly improved from 6 to 20 weeks after the administration of CL2020. The cystic cavity was smaller in the CL2020 group. Furthermore, larger numbers of descending 5-HT fibers were preserved in the distal spinal cord. Muse cells in CL2020 were considered to have differentiated into neuronal and neural cells in the injured spinal cord. Neuronal and neural cells were identified in the gray and white matter, respectively. Importantly, these effects were reversed by the selective ablation of human cells by diphtheria toxin. Conclusions: Intravenously administered Muse cells facilitated the therapeutic potential of CL2020 for severe subacute spinal cord injury.

Trichinella spp. are etiological zoonotic agents spread throughout the world affecting mammals, birds, and rep-tiles, involved in the evolution of the two cycles, domestic and sylvatic. The pine marten (Martes martes) is a mammal carnivorous nocturnal from the family Mustelidae. In Romania, this host is widespread in all the forests of the country. The pine marten has an extremely voracious appetite, feeding on fruit but also on a variety of small animals, including rodents such as mice or rats. The aim of the study was identification and molecular characterization of Trichinella larvae isolated from the muscles of tree martens from different counties of Romania. The muscle samples were examined by artificial digestion, and the larvae were processed by multiplex PCR. Trichinella britovi, a species frequently identified in wild carnivores in temperate zones, has been confirmed. Although T. britovi has been reported in Romania to several host animals, this study confirms for the first time its presence in the pine marten, a result which undoubtedly underlines the fact that the parasitic reserve in the sylvatic environment is maintained at a consistent level, and the knowledge of these vector hosts remains a permanent concern of the specialists.

The large American liver fluke (Fascioloides magna) is considered an invasive trematode parasite in Europe. Its origin dates back before the Cretaceous-Paleogene Mass Extinction, after which it survived at least three population bottlenecks, and successful host switches before it arrived in Europe. The authors review the evolutionary history of F. magna, the distribution by its ancient proboscidean hosts and the probable drivers of switch to the white-tailed deer (Odocoileus virginianus). The review collects knowledge on the biology of intermediate hosts, which help understand the factors that influence the epidemiology of F. magna in aquatic ecosystems. The authors demonstrate the adaptation potential of the parasite by data from both the North American and the European endemics. Finally, the study calls attention to the epidemiological risk of human induced global change, with a special interest to the invasive snail species, Pseudosuccinea columella.

Single-cell RNA sequencing (scRNA-seq) technology has significantly advanced our understanding of the diversity of cells and how this diversity is implicated in diseases. Yet, translating these findings across various scRNA-seq datasets poses challenges due to technical variability and dataset-specific biases. To overcome this, we present a novel approach that employs both an LLM-based framework and explainable machine learning to facilitate generalization across single-cell datasets and identify gene signatures to capture disease-driven transcriptional changes. Our approach uses scBERT, which harnesses shared transcriptomic features among cell types to establish consistent cell-type annotations across multiple scRNA-seq datasets. Additionally, we employ a symbolic regression algorithm to pinpoint highly relevant yet minimally redundant models and features for inferring a cell type’s disease state based on its transcriptomic profile. We ascertain the versatility of these cell-specific gene signatures across datasets, showcasing their resilience as molecular markers to pinpoint and characterize disease-associated cell types. Validation is carried out using four publicly available scRNA-seq datasets from both healthy individuals and those suffering from ulcerative colitis (UC). This demonstrates our approach’s efficacy in bridging disparities specific to different datasets, fostering comparative analyses. Notably, the simplicity and symbolic nature of the retrieved gene signatures facilitate their interpretability, allowing us to elucidate underlying molecular disease mechanisms using these models.

This mini-review deals with some non-starter lactic acid bacteria (NSLAB) species with a controversial nature known to be both human and animal pathogens but also health-promoting and probiotic. The focus is put on Lactococcus garvieae, two Streptococcus species (Str. uberis and Str. parauberis), four Weissella species (W. hellenica, W. confusa, W. paramesenteroides and W. cibaria) and Mammalicoccus sciuri which worldwide are often found within the microbiotas of different kinds of cheese, mainly traditional artisanal ones made from raw milk and/or relying on environmental bacteria for their ripening. Based on literature data, their virulence and health-promoting effects are examined, and some of the mechanisms of these actions are investigated. Additionally, their possible roles in cheese ripening are also discussed. The analysis so far showed that, in general, the pathogenic and the beneficial strains, despite belonging to the same species, show pretty different genetic constitutions. Yet, when the safety of a given strain is assessed, genomic analysis on its own is not enough, and a polyphasic approach is needed including additional physiological and functional tests.

Increased insulin levels may support the development of neural circuits involved in cognition, while chronic mild inflammation may also result in cognitive impairment. This study aimed to gain more insight into whether cognition is impacted already during adolescence in a genetic rat model for obesity and type 2 diabetes. Cognitive functioning throughout adolescence and early adulthood was investigated in Zucker Diabetic Fatty (ZDF), ZDF lean and healthy outbred Long Evans rats using operant touchscreens. Blood glucose, insulin and lipids were longitudinally analyzed. Histological analyses were performed in the liver, white adipose tissues and the prefrontal cortex. Adolescent ZDF obese rats outperformed lean rats on visual discrimination performance. During the longitudinal cognitive testing period, insulin levels sharply increased over weeks in ZDF obese rats and were significantly enhanced from 6 weeks of age onwards. Early signs of liver steatosis and enlarged adipocytes in white adipose tissue were observed in ZDF early adult obese rats. Histological analyses at early adulthood showed no group differences in the number of prefrontal cortex neurons and microglia, nor PSD95 and SIRT1 mRNA expression levels. Together, our data show that adolescent obese ZDF rats even display enhanced cognition despite their early diabetic profile.

Bone growth plate abnormalities and skull shape defects are seen in hypophosphatasia, a heritable disorder in humans that occurs due to deficiency of Tissue Nonspecific Alkaline Phosphatase (TNAP, Alpl) enzyme activity. Abnormal development of the cranial base growth plates (synchondroses) and abnormal skull shapes have also been demonstrated in global TNAP-/- mice. To distinguish local vs. systemic effects of TNAP on skull development, we utilized P0-Cre to knockout TNAP only in cranial neural crest derived tissues using TNAP flox mice. Here we show that TNAP deficiency in cranial neural crest leads to leads to skull shape defects and deficient growth of the intersphenoid synchondrosis (ISS). ISS chondrocyte abnormalities included increased proliferation in resting and proliferative zones with decreased apoptosis in hypertrophic zones. ColX expression is increased, indicative of premature differentiation in the absence of TNAP. Sox9 expression is increased in both resting and prehypertrophic zones of mutant mice. Expression of PTHrP and IHH were also increased. Finally, cranial base organ culture revealed that inorganic phosphate (Pi) and pyrophosphate (PPi) have specific effects on cell signaling and phenotype changes in the ISS. Together, these results demonstrate that TNAP expression in growth plate chondrocytes is essential for normal development, and that the mechanism likely involves Sox9, PTHrP, IHH and PPi.

This study aimed to evaluate the proliferation and migration of fibroblast cells derived from chronic wounds and investigate the impact of low-level laser therapy (LLLT) on their growth and migration. A total of 60 dermal samples were obtained from three sites of chronic pressure ulcers and diabetic ulcers in 20 patients. Following collection in the operating room, the dermal samples were isolated using the procedure described by Freshney RI. Fibroblasts from the wound base (Site 1) exhibited a slow proliferation rate and a decrease in proliferative capacity. Fibroblasts from wound margins (Site 2) and adjacent healing skin (Site 3) could be successfully isolated and maintained for multiple generations without any morphological changes. Fibroblasts from chronic wounds at Sites 2 and 3 showed slower proliferation rates and reduced migration capabilities compared to normal dermal fibroblasts (control samples). The fibroblast cells were exposed to LLLT at different energy levels (2.5, 3, and 3.5 J/cm2). The laser-treated groups demonstrated a significantly higher increase in cell count compared to the control sample, with the highest increase observed at an energy level of 3 J/cm2. These findings suggest that LLLT at an energy level of 3 J/cm2 could effectively enhance fibroblast migration, indicating its potential as a therapeutic intervention for chronic wounds.

Water deficit greatly affects global crop growth and productivity, particularly in water-limited environments like upland rice cultivation, leading to reduced grain yield. Plants activate various defense mechanisms during water deficit, involving numerous genes and complex metabolic pathways. Exploring orthologous genes, linked to enhanced drought tolerance, can aid functional validation in target species using genomic data from model organisms. Here, we studied the OsCPK5 gene in upland rice, an AtCPK6 ortholog from A. thaliana, by overexpressing it in the BRSMG Curinga cultivar. Transformants were assessed under two conditions: water deficit applied 79 days after seeding, lasting 14 days, followed by 7 days of irrigation at 80% field capacity. Physiological data and samples were collected at R3, R6, and R8 stages. GM plants consistently exhibited higher OsCPK5 gene expression across stages, peaking during grain filling. During this phase, GM plants displayed reduced stomatal conductance, photosynthetic rate, and increased water use efficiency compared to non-GM plants under drought. GM plants also exhibited higher filled grain percentage in both irrigation conditions. Their drought susceptibility index was 0.9 times lower than NGM plants, and they maintained a higher chlorophyll a/b index, indicating sustained photosynthesis. NGM plants under water deficit exhibited more leaf senescence, while OsCPK5-overexpressing plants retained green leaves. Overall, OsCPK5 overexpression induced diverse drought tolerance mechanisms, hinting at potential for future development of more drought-tolerant rice cultivars.

Being a great source of protein, B-vitamins and minerals, meat and fish are staple foods in many cultures. However, cooking at high temperatures can produce chemicals associated with an increased risk of developing cancer. This review investigates the possible carcinogenic activity of chemicals formed during the cooking of meat and fish including heterocyclic amines (HCAs), polycyclic aromatic hydrocarbons (PAHs), and advanced glycation end products (AGEs). High-temperature cooking methods for meat, including grilling or frying, result in the formation of HCAs. Meat that has been smoked, grilled, or cooked over an open flame produces PAHs whereas, dry heat methods including roasting, grilling, and frying results in formation of AGEs. In vitro studies have shown that these compounds can damage DNA, cause mutations, and promote the growth of cancer cells. Research shows that thoroughly cooked meat increases the risk of cancer, particularly colorectal, pancreatic, and prostate cancer. Alternative cooking techniques, marinades, and incorporating fruits and vegetables can help to mitigate this risk. For determining the efficacy of these measures, additional studies are required. For the purpose of lowering the potential carcinogenic activity of chemicals formed during the cooking of meat and fish, mitigation techniques must be understood and put into practice. Cancer can be avoided by informing people about the dangers of eating meat and fish that have been cooked at high temperatures and by encouraging better diets and cooking styles. In order to lessen the possible health concerns related to the eating of meat and fish, further studies are required.

Smartphone Addiction is a social issue caused by excessive smartphone use, affecting decision-making processes. Current research on the risky decision-making abilities of smartphone addicts is limited. This study used the fNIRS brain imaging technique and a Sequential Risk-Taking Task experimental paradigm to investigate the decision-making behavior and brain activity of smartphone addicts under varying risk levels. Using a mixed experimental design, the research assessed decision-making ability and brain activation levels as dependent variables across two groups (addiction and control), two risk amounts (high and low), and two outcomes (gain and loss). The study included 42 participants, with 25 in the addiction group and 17 in the control group. Results indicated that risk level significantly impacted the decision-making ability of smartphone addicts, with high-risk levels leading to weaker decision-making ability and increased risk-taking. However, at low risk levels, decision-making abilities between addicts and healthy individuals showed no significant difference. Furthermore, brain imaging results using fNIRS revealed stronger brain activation in the dlPFC region for smartphone addicts under loss outcome conditions, with no significant differences between the two groups in terms of brain activation at varying risk volumes. These findings are critical in promoting healthy smartphone use, guiding clinical treatment, and advancing brain mechanism research.

Melanoma is a highly aggressive type of skin cancer produced by malignant transformation of melanocytes and it is usually associated with a poor prognosis. Clinically, melanoma has several stages associated with migration and invasion of the cells through the skin layers, rapid cell spreading and formation of tumors in multiple organs. The main problem is the emergence of resistance of melanoma to the applied methods of treatment, thus it is of primary importance to find more crucial signaling pathways that control the progression of this type of cancer and could be targeted to prevent melanoma spreading. The main life-threatening stage of melanoma is metastasis formation, and 3D cell spheroids are better suited for the study of this process. Using a combinative approach (RT-PCR, immunofluorescence, patch-clamp and calcium imaging) we showed the functional expression of mechanosensitive Piezo1 channels in SK-MEL-2 aggressive melanoma cell line. We found that chemical activation of Piezo1 by its selective agonist Yoda1 completely prevents melanoma spheroid formation, and could be considered as a novel approach for the prevention of melanoma development.

This review delves into the significance of chemical communication in mammals, with an emphasis on the role of the vomeronasal system in sensing pheromone-mediated interactions. The vomeronasal system shapes a variety of social and sexual behaviors, including reproduction, hierarchy formation, maternal bonding, and species recognition. Intriguingly, this system presents a vast degree of evolutionary variability, more so than variations observed in the olfactory system. This adaptive diversity underscores the challenges in studying the vomeronasal system, emphasizing the need for detailed research into its neuroanatomy and functional morphology. This review traverses an array of topics central to our understanding of chemical communication in mammals. We begin with the foundational role and basic concepts of chemocommunication. This is followed by an in-depth exploration of the olfactory systems. Subsequently, the neuroanatomical underpinnings of the vomeronasal system are juxtaposed against those of the olfactory system. Our focus then shifts to an exhaustive study of the sensory element of the vomeronasal system, the vomeronasal organ, and the integrating center of this information, the accessory olfactory bulb. The discussion extends to secondary projections of both the olfactory and vomeronasal systems in the light of the dual olfactory hypothesis. The review culminates with a detailed look at four specific models of vomeronasal system organization belonging to four evolutionarily distinct mammalian families: rodents, marsupials, herpestids, and bovids. These have been meticulously analyzed by the authors, aiming to spotlight the significant morphofunctional differences stemming from the adaptive changes imprinted on the system.

Recent studies revealing varied responses of infected cells to LRAs underscore the limited effectiveness of these agents and emphasize the wide array of determinants contributing to the heterogeneity of reservoirs, including virus genetic background, cell model, cell type, silencing mechanisms, tissue reservoirs, integration sites, patient, and gender specific factors. The enhancer region of the HIV-1 LTR contains two adjacent NF-κB binding sites that play a central role in mediating inducible HIV-1 gene expression. Beyond the involvement of various transcription factors, such as NF-κB, epigenetic constraints also play a pivotal role in suppressing the initiation of latent HIV transcription. Consequently, even latent viruses containing functional NF-κB sites remain unresponsive to drugs that activate NF-κB. Thus, it is evident that the activation of NF-κB alone does not suffice to trigger latent HIV, contradicting the central hypothesis of this study. The author used bioinformatics methods to analyze the viral proteins and their primer binding sites. The results show that the amino acid sequence ARG of Gag proteins of HTLV-1, HTLV-2, STLV-1 and STLV-2 match their primer binding site GGGGGCTCG in the 3'-to-5' direction and that the amino acid sequence SPR of Gag proteins of HIV-1, HIV-2, SIV and FIV match their primer binding site GGCGCCCGA in the 3'-to-5' direction. Related studies have shown that the genomic Gag/Gag-Pol complex recruits the LysRS/tRNA complex. The selective packaging of the tRNA primer requires HIV-1 Gag and Gag-Pol, and an interaction between LysRS and Gag is observed in vitro. In HIV-1, Gag/LysRS interaction depends on Gag sequences within the CTD of CA around amino acids 283-363 and motif 1 of LysRS around amino acids 208-259. It should be noted that the amino acid sequence SPR of the Gag protein is located at amino acids 148-150 within the NTD of CA, specifically at the NTD-NTD interface 1. Although this research is purely bioinformatics analysis, the relevant studies have demonstrated that Gag proteins match the HIV-1 primer binding site and possess the potential to directly activate dormant retroviruses.

Natural killer cells are associated with the pathogenesis of ulcerative colitis (UC), but their precise contributions remain unclear. The present study sought to investigate the diagnostic value of activated NK-associated genes (ANAGs) in UC. Bulk RNA-seq and scRNA-seq datasets were obtained from the Gene Expression Omnibus (GEO) and Single Cell Portal (SCP) databases. In the bulk RNA-seq, 92 differentially expressed genes (DEGs) were screened out by the “Batch correction” and “Robust rank aggregation” (RRA) methods. The immune infiltration landscape was estimated by single-sample gene set enrichment analysis (ssGSEA) and CIBERSORT, which revealed a higher abundance of activated NK cells in noninflamed UC tissues. 54 DEGs correlated with activated NK cells were identified as ANAGs. Protein-protein interaction (PPI) analysis and least absolute shrinkage and selection operator (LASSO) regression were utilized to screen out 4 key ANAGs (SELP, TIMP1, MMP7, and ABCG2) and establish an activated NK-associated gene score (ANAG score). The ANAG score demonstrated excellent diagnostic value and was validated in three external datasets. The expression of the 4 key ANAGs was validated in UC patients and healthy controls (HC) samples. Through scRNA-seq data analysis, higher expression levels of SELP, TIMP1, MMP7, and ABCG2 were observed in post-capillary venules, inflammatory fibroblasts, enterocytes, and immature enterocytes. The cell scores based on the ANAGs showed enrichment in endothelial cells and fibroblasts. In conclusion, we established and validated an ANAG score with the ability to precisely diagnose UC. The 4 key ANAGs have the potential to serve as therapeutic targets in UC.

Glucose is an important carbon sources for microbial growth, and its content in infertile soils is essential for the growth of the bacterium. Since the mechanism of oligotrophic bacterium adaptation in barren soils is unclear, the research employed RNA Seq technology to examine the impact of glucose concentration on the low nutrient bacteria BS-G1 in soil affected by desertification. RNA-Seq revealed that differentially expressed genes（DEG）histidine metabolism, glutamate synthesis, HIF-1 signalling pathway, sporulation, and TCA cycle pathway of BS-G1 were significantly enriched in 0.015 g/L glucose concentration, compared with 10 g/L glucose concentration. DEG amino acids system, two-component system, Metal Ion Transport, and nitrogen metabolism system of B. subtilis BS-G1 were significantly enriched in 5 g/L glucose concentration, compared with 10 g/L glucose concentration. In addition, The present study identified its regulation pattern and key genes under the low glucose environment (7 mRNAs, 16 sRNAs). This study primarily investigates the variances in the regulatory pathways of oligotrophic bacteria BS-G1, which holds substantial importance in comprehending the mechanism underlying the limited sugar tolerance of oligotrophic bacteria.

The development and use of selenium and iodine elements in agriculture aim to enrich agricultural food products for humans. This study was carried out as a three-factor factorial experiment in a completely randomized design (CRD). Three concentrations of sodium selenate fertilizer (0, 2, 4 mg/l), three potassium iodate (0, 2, 4 mg/l), and two supplementary radiation levels (blue light and sunlight) were used. The results showed that the highest and the lowest (3.44 & 3.12 mg/g f.w) leaf protein value was related to blue light and sunlight treatments, respectively. In the blue light treatment, the maximum and the minimum (4.77 & 3.39 mg/g f.w) leaf sugar amount was observed at 4 and 0 mg/l of the iodine, respectively. At 0 mg/l of selenium, the highest and the lowest (8.63 & 5.34 mg/g f.w) leaf vitamin C amount was recorded at the 4 and 0 mg/l of iodine, respectively. In blue light + 0 mg/l of the selenium, the highest and the lowest (2.94 & 2.10 mg/g f.w) leaf flavonoid quantity was seen at 2 and 0 mg/l of the iodine, respectively. In the blue light conditions, (5.20%) leaf nitrogen content was achieved in the selenium 4 mg/l group. In the same conditions, the maximum and the minimum (3.09 & 2.18%) leaf potassium amount was attained at selenium 2 and 4 mg/l, respectively. Under blue light conditions, the highest and the lowest (0.58 & 0.24 mg/kg dry matter) leaf selenium level was observed at 4 and 0 mg/l, respectively. In sunlightradiation levels, the maximum and the minimum (0.36 & 0.25 mg/kg dry matter) leaf selenium level were found at 4 and 0 mg/l of selenium, respectively. In the blue light conditions, the most and the lowest (1.65 & 0.72 mg/kg dry matter) seed selenium content was related to 4 and 0 mg/l of the selenium, respectively. In the blue light conditions, the highest and the lowest (8.49 & 4.25 mg/kg dry matter) leaf iodine level was recorded at 4 and 0 mg/l of iodine, respectively. In the blue light conditions, the maximum and the minimum (30.56 & 20.62 mg/kg dry matter) seed iodine value was related to 4 and 0 mg/l of the iodine, respectively. In the sunlight, the most and the lowest (24.96 & 20.29 mg/kg dry matter) seed iodine amount was achieved at 4 and 0 mg/l of the selenium, respectively.

In Burkina Faso, the infant flours produced are intended for weaning-age and malnourished children. This study was to evaluate the management of infant flour production in Ouagadougou. A survey was conducted among the production units to determine the raw materials used in the production of infant flours, the production processes, the methods of conservation of raw materials and infant flours, the types of infant flours produced as well as their packaging. The results showed that 45.45% of the production units surveyed were of the semi-industrial type against 54.54% from the artisanal and CREN types. Among the raw materials, the most used cereals were millet, sorghum and maize. As for legumes, peanuts and soybeans were the most used at respectively 35% and 31%. For the conservation of raw materials, 85.71% of infant flour producers had storage warehouses and 66% used storage pesticides. These flours produced were intended for children of wean age (37.14%) and children in nutritional recovery (62.86%). Flours were stored in an airy (94.29%), dry area/environment (88.57%) and in the presence of light (91.43%). All the results of this survey reflect that efforts are still expected to further improve the nutritional and sanitary quality of the infant flours produced.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Recent advancements in the study of the protein complex photosystem II have clarified the sequence of events leading to the formation of oxygen during the S3->S4->S0 tran-sition, wherein the inorganic Mn4Ca(µ-O)6(OHx)4 cluster finishes photo-catalyzing the water splitting reaction (Greife et al, Nature 2023, 617, 623-628; Bhowmick et al, Nature 2023, 617, 629-636) . During this final step a tyrosine radical (TyrZ), stable for a couple of milliseconds, oxidizes a cluster bound oxygen while the hydrogen bonding patterns of nearby waters shift a proton away. A treatment of this redox reaction within the context of accepted transition state theories predicts rate constants that are significantly higher than experimentally recovered values (10^12s^-1 versus 10^3s^-1). In an effort to understand this disparity, temperature dependent experiments have revealed large entropic con-tributions to the rates with only a moderate energy of activation. We suggest that the entropic source may be related to the observed proton rearrangements, and further possible near isoenergetic variations in the nearby extended h-bonding network de-laying the realization of an ‘ideal’ transition state. In the following we explore this re-lation in the context of Eyring’s transition state theory and Marcus’ electron transfer theory, and evaluate their compatibility with the experimental evidence.

In potato, high levels of nitrogen (N) can lead to excessive vegetative growth at the expense of tuber development, resulting in lower yield and poor quality tubers. We found that Solanum tuberosum CLE4 (StCLE4) is expressed most strongly in the roots on N-rich media and positively regulates root growth of potato in N-deficient conditions. We noted that StCLE4 functions as a negative regulator of normal shoot apex development similar to CLV3 in Arabidopsis. Transcriptomic analysis revealed that overexpression of StCLE4 results in repression of the StIT1 gene, a regulator of potato tuber initiation. Overexpressing StCLE4 stolons were transformed into branches that were similar to milder it1 phenotype. We also found that NIN-like proteins, key regulators of nitrate signaling, bind to the regulatory sequence of StIT1 in yeast one-hybrid assay. Taken together, our findings suggest that StCLE4 regulates shoot, root and stolon growth in potato.

Aminoacyl-tRNA synthetases (aaRSs) originated from an ancestral bidirectional gene (mirror symmetry) and through the evolution of the genetic code the twenty aaRSs exhibit a symmetrical distribution in a 6-dimensional hypercube of the Standard Genetic Code. In this work, we assume a primeval RNY code, and the Extended Genetic RNA code type II which includes codons of the type YNY, YNR and RNR. Each of the 4 subsets of codons can be represented in a 4-dimensional hypercube. Altogether these 4 subcodes constitute the 6-dimensional representation of the SGC. We identify the aaRSs' symmetry groups in each of these hypercubes. We show that each of the four hypercubes contains the following sets of symmetries for the two known Classes of synthetases: RNY: dihedral group D2; YNY: binary group Z2; YNR: amplified octahedral group Oh; and RNR: binary group Z2. We demonstrate that for each hypercube, the group of symmetries of Class 1 is the same as the group of symmetries of Class 2. The biological implications of these findings are discussed.

Skeletal muscle is a specialized tissue consisting of nondividing and multinucleated muscle fibers. Skeletal muscle-specific myostatin (MSTN) is a secreted protein that acts as a negative regulator of muscle mass by inhibiting proliferation and differentiation of myoblasts. In this study, we established a screening platform to monitor myostatin promoter activity in rat L8 myoblasts. Extract of Glycyrrhiza uralensis (GUE), an oriental herbal medicine, was identified through this screening platform and, the active fractions of GUE were identified by process-scale liquid column chromatography system. For in vivo study, the GUE as a feed additive was investigated in growth-finishing pigs. The results showed that GUE significantly increased body weight, carcass weight and lean content in pigs. Microbiota analysis indicated that GUE did not affect the composition of gut microbiota in pigs. In summary, this established rodent myoblast screening platform was used to identify a myogenesis-related phytogenic, GUE, and further demonstrated that the active fractions inhibited MSTN expression. These finding suggest a novel application for GUE in growth performance enhancement through modulation of MSTN expression. Furthermore, this established screening platform has great potential for identification and evaluation of a wide variety of phytogenics involving in myogenesis.

The conventional phytopathogen Pseudomonas syringae has been identified several significant virulence determinants against Caenorhabditis elegans, but their mechanisms of action remain elusive. Here, we report the nematicidal activity and action receptor of a methyl-accepting chemotaxis protein (MCP03) of a wild-type P. syringae MB03 against C. elegans. Purified MCP03 exhibited significant nematicidal toxicity against C. elegans, with a half-lethal concentration of 124.4 μg mL1, and detrimental effects on the growth and brood size of C. elegans. Additionally, MCP03-treated worms showed severe pathological destruction of the intestine and ovary, and depressed wrinkles of the cuticle. Through yeast two-hybrid assays, we identified a subunit of a COP9 signalosome, namely CSN-5, functionated as an action receptor of MCP03. In vitro pull-down and in vivo co-localization assays verified the binding interaction between MCP03 and CSN-5. RNA interference assays confirmed that MCP03 acts on CSN-5 to adversely affect the brood size, growth, and cuticle integrity of C. elegans. Following MCP03 infection, the expression of several genes relative to reproduction, growth, and cuticle formation, such as kgb-1, unc-98, and col-117, were significantly downregulated, which implicated the pathological changes of MCP03-treated nematodes. Thus, this study demonstrates that MCP03 acted on the receptor protein CSN-5 causing lethality and detrimental effects on the fertility, growth, and morphogenesis of C. elegans, which will provide new insights into the signaling pathways and mechanism underlying the nematicidal action of MCP03 towards C. elegans.

In the struggle for survival, all organisms have evolved adaptations for protection from predation. Angiosperms are among the most abundant producers on the planet, but they are trapped in a precarious symbiosis with animals for pollination and fruit dispersal, while also having to deter herbivory. About 10% of all angiosperms produce the deterrent latex from ubiquitous isoprene precursors. Latex is an aqueous suspension of rubber particles and other compounds which works as an antifeedant by clogging chewing mouthparts and by coagulating into a solid in stomach acid. A survey of stomach pHs from various animals supports the hypothesis that foregut-fermenting ruminants have evolved the capacity to evade latex coagulation due to the presence of anterior digestive chambers with near-neutral to alkaline pH before it enters the acidic abomasum. Hindgut-fermenting animals lack this adaptation and have to eat forage which is low in latex, such as grasses. The latex-adaptive foregut browsers vs. latex-maladapted hindgut grazer hypothesis has implications for both livestock and zoo animals which may be provided with forage that is not optimal for their gut health. Further, ruminants and herbivorous tadpoles are at risk for damage by popular bioinsecticides such as Bt which are activated by alkaline gut pH.

The metabolism of lipoproteins, which regulates the transit of the lipid to and from tissues, is crucial to maintaining cholesterol homeostasis. Cardiac remodeling is referred to as a set of molecular, cellular, and interstitial changes that, following injury, affect the size, shape, function, mass, and geometry of the heart. Acetyl coenzyme A (acetyl CoA), which can be made from glucose, amino acids, or fatty acids, is the precursor for the synthesis of cholesterol. In this article, authors explain concepts behind cardiac remodeling, its clinical ramifications, and the pathophysiological roles played by numerous various components, such as cell death, neurohormonal activation, oxidative stress, contractile proteins, energy metabolism, collagen, calcium transport, inflammation, and geometry. The levels of cholesterol are traditionally regulated by two biological mechanisms at the transcriptional stage. First, the SREBP transcription factor family regulates the transcription of crucial rate-limiting cholesterogenic and lipogenic proteins, which in turn limits cholesterol production. Immune cells become activated, differentiated, and divided, during an immune response with the objective of eradicating the danger signal. In addition to creating ATP, which is used as energy, this process relies on metabolic reprogramming of both catabolic and anabolic pathways to create metabolites that play a crucial role in regulating the response. Because of changes in signal transduction, malfunction of the sarcoplasmic reticulum and sarcolemma, impairment of calcium handling, increases in cardiac fibrosis, and progressive loss of cardiomyocytes, oxidative stress appears to be the primary mechanism that causes the transition from cardiac hypertrophy to heart failure. De novo cholesterol production, intestinal cholesterol absorption, and biliary cholesterol output are consequently crucial processes in cholesterol homeostasis. In the article's final section, the pharmacological management of cardiac remodeling is explored. The route of treatment is explained into different steps: including, promising, and potential strategies. This chapter offers a brief overview of the history of the study of cholesterol absorption as well as the different potential therapeutic targets.

African swine fever (ASF) is a lethal and highly contagious transboundary animal disease with the potential for rapid international spread. Currently, there is no ASF vaccine commercially available. All infected animals must be isolated and culled immediately upon confirmation of the presence of the virus. Works leading to the rational development of protective ASF vaccines are urgently needed. Here, we generated a safe and efficacious live-attenuated vaccine (LAV) VNUA-ASFV-LAVL2 by serial passaging of a field isolate (VNUA-ASFV-05L1, genotype II) in porcine alveolar macrophage (PAMs, 65 passages) and an immortalized porcine alveolar macrophage cell line (3D4/21, 55 passages). VNUA-ASFV-LAVL2 can efficiently replicate in both PAMs and 3D4/21 cells. It provides 100% protection, even with the low dose of 10^2 HAD50, for the vaccinated pigs against the challenge of contemporary pandemic ASFV field isolate. Pigs vaccinated with this LAV at a dose range of 10^2 to 10^5 HAD50 remained clinically healthy during both the 28-day observation period of immunization and the 28-day observation period of challenge. VNUA-ASFV-LAVL2 was completely eliminated from blood by 28 days post inoculation (DPI), and from feces or oral fluids by 17 DPI. It remained a safe, stable, and attenuated phenotype after five passages in pigs. Consistently high levels of ASFV-specific IgG antibodies and significant cellular immunity were detected in vaccinated pigs before the ASFV challenge. These results indicate that the VNUA-ASFV-LAVL2 strain is a safe and efficacious LAV against the genotype II ASFV strain responsible for current ASF outbreaks in Asia.

Abstract: Autophagy has a dual role in gliomagenesis in a microRNA-modulated environment. We investigated the potential relevance of autophagy in glioma development and survival by exploring the association of autophagy-associated genes and microRNAs in low- and high-grade gliomas. Real-time PCR (qPCR) was used to determine the expression of genes and microRNAs in 50 fresh glioma tissues while Formalin-fixed paraf-fin-embedded tissues of the same patients were used for immunohistochemistry. The Mann-Whitney U-test test, Spearman correlation test, and Kaplan-Meier survival analysis were performed to evaluate the expression, association, and overall survival in patients respectively. The expression of LC3, AKT, and miR-21 was increased in high-grade glioma compared to low-grade glioma while ULK2 expression was decreased in high-grade glioma. A strong positive correlation was observed for ULK2 with UVRAG, PTEN, miR-7, and miR-100, while the moderate correlation with mTOR, Beclin1, miR-30, miR-204, miR-374, miR-21 and miR-126 in low-grade glioma, while a moderate positive correlation between ULK2 and PI3K, PTEN, ULK1, VPS34, mTOR, Beclin1, UVRAG, AKT and miR-374, and between AKT and ULK1, VPS34, UVRAG, and miR-7 in high-grade gliomas. The low ULK2 and LC3 expression group was significantly associated with better overall survival in gliomas while miR-21 overexpression showed a poor prognosis in glioma patients. Therefore, miR-21, ULK2, and LC3 may serve as prognostic biomarkers for survival outcomes in glioblastoma.

Ribotoxin-like proteins (RL-Ps) are specific ribonucleases found in mushrooms that are able to cleave a single phosphodiester bond located in the Sarcin-Ricin Loop (SRL) of the large rRNA. The cleaved SRL interacts differently with some ribosomal proteins (P-stalk). This action blocks protein synthesis because the damaged ribosomes are unable to interact with elongation factors. Here, the amino acid sequence of eryngitin 3 and 4, RL-Ps isolated from Pleurotus eryngii fruiting bodies, was determined to: i) obtain structural information on this specific ribonuclease family from edible mushrooms; and ii) explore the structural determinants which justify their different biological and antipathogenic activities. Indeed, eryngitin 3 (exhibited higher toxicity with respect to eryngitin 4 against tumoral cell lines and model fungi. Structurally, eryngitin 3 and 4 consist of 132 amino acids, most of them identical and exhibit a single free cysteinyl residue. The amino acidic differences between the two toxins are: i) an additional phenylalanyl residue at the N-terminus of eryngitin 3, not retrieved in eryngitin 4; and ii) an additional arginyl residue at C-terminus of eryngitin 4, not retrieved in eryngitin 3. The 3D-models of eryngitins show slight differences at the N- and C-terminal regions. In particular, the positive electrostatic surface at C-terminal of eryngitin 4 is due to the additional arginyl residue not retrieved in eryngitin 3. This additional positive charge could interfere with the binding to the SRL (substrate) or with some ribosomal proteins (P-stalk structure), during substrate recognition.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Multiple sclerosis (MS) is a chronic inflammatory autoimmune disease of the central nervous system. According to recent studies, cellular senescence caused by telomere shortening may contribute to the development of MS. Aim of the study: to determine the associations of TEP1 rs1760904, rs1713418, TERC rs12696304, rs35073794 gene polymorphisms with the occurrence of MS. Methods: The study included 200 patients with MS and 230 healthy controls. Genotyping of TEP1 rs1760904, rs1713418 and TERC rs12696304, rs35073794 was performed using RT-PCR. Statistical analysis of the obtained data was performed using the program "IBM SPSS Statistics 29.0". Haplotype analysis was performed using the online program "SNPStats". Results: The TERC rs12696304 G allele of this SNP is associated with a 1.4-fold lower odds of developing MS (p=0.035). TERC rs35073794 is associated with an approximately 2.4-fold reduced odds of MS occurrence in the codominant, dominant, overdominant, and additive models (p < 0.001; p < 0.001; p < 0.001; p < 0.001, respectively). Haplotype analysis shows that the rs1760904-G - rs1713418-A haplotype is statistically significantly associated with a 1.75-fold increased odds of developing MS (p=0.006). The rs12696304-C - rs35073794-A haplotype is statistically significantly associated with a 2-fold decreased odds of developing MS (p=0.008). In addition, the rs12696304-G - rs35073794-A haplotype was found to be statistically significantly associated with a 5.3-fold decreased odds of developing MS (p&lt;0.001). Conclusion: Current evidence may suggest a protective role of TERC SNP in the occurrence of MS, while TEP1 has the opposite effect.

The natural flavonoid epigallocatechin gallate (EGCG) has a wide range of biological activities including binding to nucleic acids; however, mechanisms of interaction of EGCG with DNA organized in chromatin have not been systematically studied. In this work, interaction of EGCG with chromatin in cells, and with nucleosomes and chromatosomes in vitro was studied using fluorescent microscopy and single particle Förster resonance energy transfer approaches, respectively. EGCG effectively penetrates into the nuclei of living cells and binds to DNA there. Interaction of EGCG with nucleosomes in vitro induces large-scale, reversible uncoiling of nucleosomal DNA that occurs without dissociation of DNA or core histones at sub- and low-micromolar concentrations of EGCG. EGCG does not reduce the catalytic activity of poly(ADP-ribose) polymerase 1 (PARP1), but causes modulation of the structure of the PARP1-nucleosome complex. EGCG significantly changes the structure of chromatosomes, but does not cause dissociation of the linker histone. Reorganization of nucleosomes and chromatosomes by EGCG might facilitate access of protein factors involved in DNA repair, replication and transcription to DNA and thus might contribute to the modulation of gene expression by EGCG that was reported earlier.

Interactions between proteins and ions are essential for various biological functions like structural stability, metabolism, and signal transport. Given that more than half of all proteins bind to ions, it becomes crucial to identify ion-binding sites. Accurate identification of protein-ion binding sites helps us to understand proteins’ biological functions and plays a significant role in drug discovery. While several computational approaches have been proposed, this remains a challenging problem due to the small size and high versatility of metals and acid radicals. In this study, we propose IonPred, a sequence-based approach that employs ELECTRA (Efficiently Learning an Encoder that Classifies Token Replacements Accurately) to predict ion binding sites using only raw protein sequences. We successfully fine-tuned our pretrained model to predict the binding sites for nine metal ions (Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, and K+) and four acid radical ion ligands (CO32−, SO42−, PO43−, NO2−). IonPred surpassed six current state-of-the-art tools by over 44.65% and 28.46% respectively in F1 score and MCC when compared on an independent test dataset. Our method is more computationally efficient than existing tools producing prediction results for a hundred sequences for a specific ion in under ten minutes.

The hawthorn fruit, a member of the Rosaceae family, is a medicinal plant with numerous therapeutic properties. It exhibits a wide range of variants, with Crataegus tanacetifolia being Turkey's most widely recognized species. The hawthorn fruit has various biological activities, including anti-inflammatory, antibacterial, antioxidant, immune-modulating, and anti-carcinogenic properties. Vinegar was produced from the hawthorn fruit and the techniques of pasteurization and ultrasound were employed to enhance the antioxidant capabilities and extend the shelf life. A total of 56 mature Wistar-Albino rats were allocated into seven groups and administered hawthorn fruit vinegar via oral gavage on a daily basis. The experimental groups were classified as pasteurized (HVP) and ultrasound (HVU) treated, with two different dosage levels (0.5 and 1 mg/kg), and a control group consisting of regular vinegar. The SOD, MDA, and CAT antioxidant levels were measured using the ELISA method in plasma and liver tissue samples. The total cholesterol, triglyceride, HDL, LDL, AST, and ALT values were quantified in commercially available kits. The levels of SOD and CAT in the plasma and liver were found to be significantly higher in the HVU1 group. In a manner akin to those mentioned, the HVU1 cohort exhibited the highest HDL value. The levels of LDL were comparably low in both the thermal pasteurized and ultrasound treatment groups. This finding agrees with HDL levels and is statistically significant (p≤0.05). There were significant expressions of both CAT and SOD in HVU groups in liver tissues immunohistochemically. The possible therapeutic effects of hawthorn vinegar may boost its antioxidant capabilities and contribute to an overall improvement in quality of life.

Leishmaniasis is a group of neglected infectious, non-contagious diseases caused by parasites of the Leishmania genus which affects millions of people worldwide. The drugs available for its treatment, especially in cases of visceral leishmaniasis, are old, outdated, have serious side effects and in many cases are ineffective due to the emergence of resistant strains. In this context, the search for new candidates for more effective and safer drugs which can become new therapeutic alternatives is a constant need. In this work, 10 new chalcones were synthesized in high yields through Claisen-Schmidt condensation and were evaluated in vitro against Leishmania infantum promastigotes and amastigotes. CP04 and CP06 compounds were the most promising, respectively showing IC50 values = 13.64 ± 0.25 and 11.19 ± 0.22 against promastigotes, and IC50 = 18.92 ± 0.05 and 22.42 ± 0.05 against amastigotes. The compounds did not show cytotoxicity in erythrocytes, showing selectivity indexes greater than 74 and 90. Molecular docking studies carried out under the sterol 14-alpha demethylase (CYP-51) (PDB: 3L4D) and trypanothione reductase (PDB: 5EBK) enzymes from L. infantum evidenced the great affinity of the CP04 molecule for these targets, showing Moldock score values of -94.0758 and -50.5692 KJ/mol-1, with these values being much lower than the co-crystallized ligand energies. Molecular dynamics simulations demonstrated great stability of CP04 in its targets, thus indicating a real interaction possibility. Our findings confirm the potential that chalcones have as candidates for anti-leishmania drugs, and suggest that the CP04 compound may become a promising drug candidate to design and develop novel chalcone-based analogs for leishmaniosis therapy.

Abstract: The ability to detect several types of cancer using a non-invasive, blood-based test holds the potential to revolutionize oncology screening. We mined tumor methylation array data from the Cancer Genome Atlas (TCGA) covering 14 cancer types and identified two novel, broadly oc-curring methylation markers at TLX1 and GALR1. To evaluate their performance as a general-ized blood-based screening approach, along with our previously reported methylation bi-omarker, ZNF154, we rigorously assessed each marker individually or combined. Utilizing the TCGA methylation data and applying logistic regression models within each individual cancer type, we found that the three-marker combination significantly increased the average area under the ROC curve (AUC) across the 14 tumor types compared to single markers (p= 1.158e-10; Friedman test). Furthermore, we simulated dilutions of tumor DNA into healthy blood cell DNA and demonstrated increased AUC of combined markers across all dilution levels. Finally, we evaluated assay performance in bisulfite sequenced DNA from patient tumors and plasma, in-cluding early-stage samples. When combining all three markers the assay achieved 100% sensi-tivity and specificity, as demonstrated in lung cancer plasma samples. In patient plasma from hepatocellular carcinoma, ZNF154 alone yielded the highest combined sensitivity and specificity values averaging 68% and 72%, whereas multiple markers could achieve higher sensitivity or specificity, but not both. Altogether this study presents a comprehensive pipeline for the identifi-cation, testing and validation of multi-cancer methylation biomarkers with a considerable poten-tial for detecting a broad range of cancer types in patient blood samples.

Macrophages undergo different cellular states upon activation that can be hyporesponsive (tolerated) or hyperresponsive (primed or trained) to subsequent stimuli. Epigenetic modifications are known to play a key role in determining these cellular states. However, little is known about the role of signaling pathways that lead to these epigenetic modifications. Here, we examined the effects of various inhibitors targeting key signaling pathways induced by lipopolysaccharide (LPS) on tolerance and priming in the murine macrophages. We found that a prolonged inhibition (>18 h) of the MEK1/2-ERK signaling axis reversed tolerance and primed cells in expressing IL-1β and other inflammatory cytokines such as IL-6, TNFα, and CXCL10. Ectopic expression of catalytically active and inactive MEK1 mutants suppressed and enhanced IL-1β expression, respectively. Primed cells by the MEK1/2 inhibitor U0126 expressed higher levels of gene sets associated with immune responses and cytokine/chemokine production but lower levels of genes with cell cycle progression, chromosome organization, and heterochromatin formation than non-primed cells. Of interest, expression of the histone 3 lysine 9 (H3K9) methyltransferase Suv39h1 and the H3K9 methylation reader Cbx5 was substantially suppressed, whereas the H3K9 demethylase Kdm7a was enhanced, suggesting a role of the MEK1/2-ERK signaling axis in H3K9 demethylation. The H3K9 trimethylation levels in the genomic regions of IL-1β, TNFα, and CXCL10 were decreased by U0126. Also, the H3K9 methyltransferase inhibitor BIX01294 mimicked and overexpression of Cbx5 prevented the U0126 training effects in both RAW264.7 cells and bone marrow-derived macrophages. Collectively, these data suggest that prolonged inhibition of the MEK1/2-ERK signaling axis reverses tolerance and primed macrophages likely through decreasing H3K9 methylation levels.

Programmed aging refers to the idea that mammals (and some other multiparous sexually reproducing organisms) evolved complex biological mechanisms that cause gradually increasing fitness deterioration and internally limit individual organism lifetimes. The rationale is that this process enhances the survival (non-extinction) of a species population. Evolvability theories propose that mammals have evolved design characteristics that aid their ability to evolve, that is, reduce the time required for a particular increment of evolutionary adaptation and/or increase the precision with which the adaptation can be performed. Because an increase in evolvability aids a population in escaping extinction, evolution selects the associated design characteristics. Both of these concepts conflict with traditional (Darwinian) theory regarding the nature of evolution. However, more recent genetics discoveries have exposed rich detail regarding the nature of the evolution process including the fact that biological inheritance involves the transmission of organism design information from parent to descendant in digital form. These discoveries have acted to support both programmed aging and evolvability theories. Acquisition traits are those that depend for their evolutionary (fitness) value on the acquisition of something that gradually accumulates during an organism’s life but is not transmitted genetically to descendants. This situation causes these traits including language, immunity, intelligence, and social status to represent a special need for evolvability and programmed aging.

Sulfated polysaccharides from seaweed are highly active natural substances having valuable applications. In the present paper, attempts have been made to discuss the physicochemical and structural features of polysaccharides isolated from red marine alga Alsidium corallinum (ACPs) and its protective effect in hepatic impairments induced by tebuconazole (TBZ) in rats. Structural features were determined using High performance liquid chromatography, Fourier transformed infrared, and solid state ¹H and ¹³C-Nuclear magnetic resonance analysis. ACPs are found to be hetero-sulfated-anionic polysaccharides that contained carbohydrates, sulfate groups and uronic acids. In vitro biological activities suggested the effective antioxidant and antimicrobial capacities of ACPs. For antioxidant testing in vivo, the biochemical analysis and plasma profiles displayed that oral administration of ACPs could mitigate blood lipid indicators, including total cholesterol, triglyceride, low and high density lipoprotein cholesterol, bilirubin, liver function indexes involving alanine aminotransferase and aspartate aminotransferase, showed that ACPs possessed obvious antioxidant activities. Besides, the intervention of ACPs potentially inhibited lipid peroxidation, protein oxidation, key enzymes of lipid metabolism (<0.001) and increased levels and antioxidant status (<0.05). Histomorphological observation confirmed that ACPs intervention could partially repair liver injuries caused by TBZ. The computational results showed that A. corallinum monosaccharides bound 1JIJ, 1HD2 and 1WL4 receptors with acceptable affinities, which together with deep embedding and molecular interactions support the antioxidant, antimicrobial and hypolipidemic outlined effects in the in vitro and in vivo findings. In view of their prominent antioxidant effects, ACPs stand for promising candidates in liver diseases and need be considered in pharmaceutical applications.

While fibrinolytic enzymes and thrombolytic agents offer assistance in treating cardiovascular diseases, the existing options are associated with a range of adverse effects. In our previous research, we successfully identified ficin, a naturally occurring cysteine protease that possesses unique fibrin and fibrinogenolytic enzymes, making it suitable for both preventing and treating cardiovascular disorders linked to thrombosis. Papain is a prominent natural cysteine protease derived from the latex of Carica papaya. The potential role of papain in preventing fibrin(ogen)lytic, anticoagulant, and antithrombotic activities has not yet been investigated. Therefore, we examine how papain influences fibrinogen and the process of blood coagulation. Papain is highly stable at pH 4-11 and 37-60°C by azocasein assay. In addition, SDS gel separation electrophoresis, zymography, and fibrin plate assays were used to determine fibrinogen and fibrinolysis activity. Papain appears to have a molecular weight of around 37 kDa, and is highly effective in degrading fibrin, with a molecular weight of over 75 kDa. Furthermore, papain-based hemostatic performance was confirmed in blood coagulation tests, a blood clot lysis assay, and a κ-carrageenan rat tail thrombosis model, highlighting its strong efficacy in blood coagulation. Papain shows dose-dependent blood clot lysis activity, cleaves fibrinogen chains of Aα, Bβ, and γ-bands and significantly extends prothrombin time (PT) and activated partial thromboplastin time (aPTT). Moreover, the mean length of the infarcted regions in the tails of Sprague-Dawley rats with κ-carrageenan was shorter in rats administered 10 U/kg of papain than in streptokinase-treated rats. Thus, papain, a natural cysteine protease, has distinct fibrin and fibrinogenolytic properties, suggesting its potential for preventing or treating cardiovascular issues and thrombosis-related diseases.

Biomimetics, which are similar to natural compounds that play an important role in the metabolism, manifestation of functional activity and reproduction of various fungi, have a pronounced attrac-tion in the current search for new effective antifungals. Actual trends in the development of this area of research indicate that unnatural amino acids can be used as such biomimetics, including those containing halogen atoms; compounds similar to nitrogenous bases embedded in the nucleic acids synthesized by fungi; peptides imitating fungal analogues; molecules similar to natural sub-strates of numerous fungal enzymes and Quorum Sensing signaling molecules of fungi and yeast; etc. Most part of the review is devoted to the analysis of semi-synthetic and synthetic antifungal peptides and their targets of action. This review is aimed at combining and systematizing the cur-rent scientific information accumulating in this area of research, developing various antifungals with an assessment of the effectiveness of the created biomimetics and the possibility of combining them with other antimicrobial substances to reduce cell resistance and improve antifungal effects.

Cotton cultivation and sustaining its productivity is challenging in temperate arid regions around the globe. Exploring suitable cotton cultivation areas to improve productivity in such climatic regions is essential. Thus, this study explores the ecologically suitable areas of cotton cultivation using the Maxent model, having 375 distribution points of long-staple cotton and various factors, including 19 climatic factors, 2 terrain factors, and 6 soil factors in Xinjiang. The area under the curve (AUC) of the predicted results was greater than 0.9, indicating that the model's predictions had fairly high accuracy. However, the main environmental factors that affect cotton's growth are the lowest temperature in the coldest month, the hottest month, the precipitation in the driest season, and the monthly average temperature difference. Further, the temperature factors contribute 71%, while the contribution ratio of terrain and soil factors is only 22%. The research shows that the current planting area is consistent with the predicted area in many areas of the study. Still, some areas, such as the Turpan region, northwest of Bayingolin Mongol Autonomous Prefecture, are supposed to be suitable for planting cotton, but it is not planted. The current potential distribution area of long-staple cotton is mainly located in Aksu Prefecture and the northern part of the Kashgar Prefecture region. The climatic prediction shows that the growing area of long-staple cotton may expand to southern Altay, central Aksu, and Bortala Mongol Autonomous Prefecture. This study will be helpful for cotton cultivation suitability areas in Xinjiang and other regions with similar environments.

Hymenoptera allergens are the main triggers for anaphylaxis in susceptible dogs and humans. Hymenoptera venom specific immunotherapy (VIT), the only disease-modifying treatment, has the potential to prevent future life-threatening reactions in human patients. Prospective clinical data on VIT efficacy in dogs are currently lacking. Therefore, the aim of this study was to show that VIT is not only safe but also efficacious in preventing anaphylaxis in dogs allergic to Hymenoptera. This uncontrolled prospective clinical trial included 10 client-owned dogs with a history of anaphylaxis following repeated Hymenoptera stings. The sensitization to bee and wasp allergens was demonstrated by intradermal testing (IDT) and allergen-specific IgE serology. For VIT induction (induction phase), dogs received a shortened rush immunotherapy protocol with aqueous allergens, which was then followed by monthly injections of 100 g of alum-precipitated allergen (maintenance phase). VIT efficacy was determined by observing patients’ clinical reactions to re-stings. No systemic adverse events were seen during the induction and maintenance phase. From the seven re-stung dogs, only one developed a mild angioedema at the site of the sting; the remaining dogs were asymptomatic. These results show that VIT represents a safe and effective treatment option for Hymenoptera-allergic dogs.

Colorectal cancer is the second leading cause of cancer-related mortality worldwide. Numerous pathophysiological mechanisms, such as abnormal cell proliferation, cell differentiation, resistance to apoptosis, invasion of structures adjacent to colorectal tumor cells, and distant metastasis, are involved in colorectal carcinogenesis. These processes are initiated by the complex interaction of a number of genetic and environmental factors, including sedentary lifestyle, obesity, alcohol consumption, smoking or gut microbiota. Despite the significant progress achieved in the diagnostic and therapeutic management of patients with colorectal cancer, there has been recently a noteworthy increase in the incidence of colorectal cancer in individuals below the age of 50 years. Early-onset colorectal cancer has a different frequency of oncogenic mutations, a higher prevalence of mucinous histology, a distinct deoxyribonucleic acid (DNA) methylation profile, a more distal location, and lower survival rates. A significant improvement in the prognosis of these patients can be achieved through the detection and removal of modifiable risk factors, along with the implementation of personalized screening strategies for individuals at high risk for this malignancy. Furthermore, gaining comprehension of the pathophysiological mechanisms by which these risk factors contribute to the process of oncogenesis may facilitate the discovery of novel therapeutic targets.

The influence of four levels of dietary supplementation on the development of the immune response and on the biology of Haemonchus contortus and Trichostrongylus colubriformis was evaluated in Dorper lambs under serial artificial mixed-infections with 1000 infective larvae (L3) of each species, given every three days for 12 weeks. For each of the four diets formulated, one infected group (n=7) and one control group (n=4) were set up. Diets 1, 2, 3 and 4 contained 0%, 25%, 50% and 75% of concentrate, respectively. There was an evident immune response to infection in all groups, manifested through eosinophilia and production of anti-L3 immunoglobulins. There was a significant inverse relationship between the levels of nutrients in the diets and the numbers of late fourth-stage larvae, early fifth-stage larvae and adults of H. contortus. Most of the H. contortus parasite population was in hypobiosis at the early-fourth stage, representing 59.5%, 75.8%, 83.3% and 86.3% of the total Haemonchus worm burden, respectively, in the Diets 1, 2, 3 and 4. In the case of T. colubriformis, hypobiosis was not observed and the diet had no influence on establishment of the parasite.

Current environmental conditions have prompted agri-food systems to explore new strategies for improving the production of crops in a sustainable manner. The use of omeprazole (OMP) and melatonin (MEL) have been proposed as innovative strategy for crop improvement when applied as biostimulants. However, although their role in the growth of several species has been studied, the results in photosynthetic efficiency parameters are still scarce. Therefore, the objec-tive of the present study was to evaluate the effect of foliar application of OMP and MEL on bi-omass, yield, SPAD values, leaf chlorophyll fluorescence (Fv/Fm), photochemical quenching (qP), Non-photochemical quenching (NPQ), quantum yield of photosystem II (PhiPSII) and elec-tron transport rate (ETR) in bean plants. Treatments were applied separately at doses of 1, 10, and 100 µM, plus a control without application. The results obtained indicate that OMP and MEL were able to increase biomass, yield, SPAD values, as well as photochemical quenching, fluores-cence, and PhiPSII coefficients. Finally, it is concluded that foliar application of OMP and MEL at a dose of 1 and 10 µM can increase photosynthetic efficiency and decrease photoinhibition, which is reflected in higher biomass accumulation and yield in green bean plants cv. Strike.

In the present study, we implemented species distribution models (SDMs) to determine the potential invasive distribution range of a cichlid fish, Nile tilapia, Oreochromis niloticus, in a very sensitive inland water system in the southeastern Arabian Peninsula where it is now established and spreading. By using the “Biomod2” package, and the latest CMIP6 climate data, four single species distribution models and EM were built, and the results were evaluated by operating characteristic (ROC) and the true skill statistic (TSS). Based on the relative importance of climate factor analysis the mean diurnal range and precipitation seasonality were useful predictors of habitat suitability for O. niloticus. The response curve analysis indicated that the presence probability of O. niloticus decreased with increasing mean diurnal range and decreasing precipitation seasonality. The suitable distribution ranges for O. niloticus in the studied area were mainly distributed in the northeast of this region. The ensemble model results specified a significant impact of climate change on O. niloticus distribution, so highly suitable areas for this species will be reduced, while areas with low to moderate suitability increase slightly or remain unchanged. Based on the available data, Nile tilapia fulfills all four criteria to be considered as an invasive species: colonization in a new area, direct or indirect impacts of anthropological activity on its distribution range, geographical discontinuity between its native area (Africa) and the Arabian Peninsula (remote dispersal), and finally, its successful breeding in situ without human assistance resulting establishment of this biopollutant. Species distribution modeling provides insights into the factors that can reduce the risks and negative impacts of this biological pollutant on aquatic ecosystems of the southeastern Arabian Peninsula which harbors about 22 recognized fish species in 16 genera, 10 families, seven orders, and a class including 20 natives (seven endemic) species.

Advanced genomics, transcriptomics and epigenomics techniques are providing unprecedented insights into the understanding of the molecular underpinnings of the central nervous system, including the neuro-sensory cochlea of the inner ear. Here, we report for the first time a comprehensive and updated overview of the most advanced omics techniques for the study of nucleic acids, and their applications in cochlear research. We describe the available in vitro and in vivo models for hearing research, the principles of genomics, transcriptomics and epigenomics, alongside their most advanced technologies (like single cell omics and spatial omics), which allows to investigate the molecular events that occur at single cell resolution retaining the spatial information.

Fractures are the most common large organ trauma in humans. The initial inflammatory re-sponse promotes bone healing during the initial post-fracture phase, but chronic and persistent inflammation due to infection or other factors does not contribute to the healing process. The precise mechanisms by which immune cells and their cytokines are regulated in bone healing remain unclear. The use of mesenchymal stem cells (MSCs) for cellular therapy of bones injury is a novel clinical treatment approach. Bone progenitor MSCs not only differentiate into bone, but also interact with the immune system to promote the healing process. We review in vitro and in vivo studies on the role of the immune system and bone marrow MSCs in bone healing and their interactions. A deeper understanding of this paradigm may provide clues to potential therapeu-tic targets in the healing process, thereby improving the reliability and safety of clinical applica-tions of MSCs to promote bone healing.

Porphyrinic photosensitizers (PSs) and their nano-sized polymer-based carrier systems are required to exhibit low dark toxicity, avoid side effects, and ensure high in vivo tolerability. Yet, little is known about the intracellular fate of PSs during the dark incubation period and how it is af-fected by nanoparticles. In a systematic study, high resolution magic angle spinning NMR spectroscopy combined with statistical analyses was used to study the metabolic profile of cultured HeLa cells treated with different concentrations of the PS chlorin e4 (Ce4) alone or encapsulated in carrier systems. For the latter, either polyvinylpyrrolidone (PVP) or the micelle forming polyethylene glycol (PEG)-polypropylene glycol triblock copolymer Kolliphor P188 (KP) were used. Diffusion edited spectra indicated Ce4 membrane localization evidenced by Ce4 concentration dependent chemical shift perturbation of the cellular phospholipid choline resonance. The effect was also visible in the presence of KP and PVP, but less pronounced. The appearance of the PEG resonance in the cell spectra pointed towards cell internalization of KP whereas no conclusion could be drawn for PVP that remained NMR-invisible. Multivariate statistical analyses of the cell spectra (PCA, PLS-DA and oPLS) revealed a concentration-dependent metabolic response upon exposure to Ce4 that was attenuated by KP and even more by PVP. Significant Ce4-concentration dependent alterations were mainly found for metabolites involved in the tricarboxylic acid cycle and the phosphatidylcholine metabolism. The data underline an important protective role of the polymeric carriers following cell internalization. Moreover, the current study allowed - to our knowledge for the first time - to trace the intracellular PS localization on an atomic level by NMR methods.

The accumulation of microplastics in the world oceans is one of the main global problems of the modern world. The Black Sea is the main source of seafood for people from several countries, including Bulgaria. The pollution of the Black sea is a result of various factors, especially anthropogenic. The present study demonstrated detailed MPs contamination of five fish species important for the commercial fishing (Garfish, Мullet, Knout goby, Pontic shad and Mediterranean horse mackerel) collected from the Sozopol area on the Bulgarian Black Sea coast. Within each microplastic morphological group, three size classes were recognized: 100-200 µm, 25-100 µm, and ≤ 25 µm. Microplastics were found in the soft tissues of all studied specimens but in a different ratio of pellets, fibers and fragments. Generally, the pellets were the most often registered particles, followed by irregularly-shaped fragments, whereas fibers were less numerous. The dominant part of the isolated plastics are made of polyethylene (PE), and polyethylene terephthalate (PET). Our results pointed out serious pollution with plastic particles in the Bulgarian Black Sea aquatory, which in the future may seriously affect the health of the fish population and also human health.

The king ratsnake (Elaphe carinata) of the genus Elaphe is a common large non-venomous snake that is widely distributed in Southeast and East Asia, and is an economically important farmed snake species. As a non-venomous snake, the king snake that is predatory on venomous snakes such as cobras and pit vipers. The immune mechanisms of which has been unclear. Despite their economic and research importance, genomic resources which will benefit studies in toxicology, phylogeography and immunogenetics are lacking. In this study, we use single-tube long fragment read (stLFR) sequencing to display the first complete genome of a King ratsnake from Huangshan City, Anhui province in China. The genome size is 1.56GB with a scaffold N50 of 6.53M, the total length of the genome is approximately 621Mb, and the repeat content is 38.90%. Additionally, we predicted 22,339 protein-coding genes, of which 22,065 had functional annotations. Our genome is a potentially useful addition to those currently available for snakes.

Background: Identity diffusion plays a central role in the onset of borderline personality and disorders. The Dialectical Behavioral Therapy for Adolescents (DBT-A) is a treatment program for adolescents with emotional instability and dysregulation. The interest of this study is to examine the influence of a standardized and certified DBT-A therapy program on identity development of adolescents with emotion dysregulation in an inpatient setting. Methods: 138 adolescents aged 13 to 18 years with symptoms of emotional instability were assessed before and after a curricular 12-weeks in-patient DBT-A program with standardized instruments for the assessment of identity (AIDA), emotion regulation (FEEL-KJ, SEE) and general psychopathology (SCL-90-R, DIKJ). Results: The results indicate a significant change in identity development, emotion regulation and general symptoms of psychopathology after treatment with DBT-A. A connection between identity scales and psychopathological symptoms of adolescents with diagnosed borderline disorders and impaired emotion regulation could be established. Conclusion: In this large sample of adolescents, DBT-A significantly improved identity and reduced identity diffusion. As identiy disturbance is a core symptom of borderline personality disorder, our results may become clinically relevant for the prevention of personality disorders in emotionally unstable adolescents

Head and neck squamous cell carcinoma (HNSCC) takes the sixth place among the most common cancers in the world. Abnormal methylation can be one of the reasons for this cancer. The aim of this study was to investigate the DNA promotor methylation status of cancer-associated genes (ATM, APC, CDO1, RB1, TP53, WIF1) in patients with HNSCC. Bisulfite Conversion and Methylation-Sensitive High-Resolution Melting was used for analysis of the DNA methylation level of normal and tumor tissues in 44 patients. There were significant differences in DNA methylation level between patient’s tumor and normal tissues for CDO1 and WIF1 genes in all subjects and subgroups (p<0.05). In T3 subgroup there was significant correlation between CDO1 gene methylation and age in the normal tissue. The same correlation was detected also for the WIF1 gene methylation in tumor tissue samples in the subgroup with T3 and in normal tissue samples in the subgroup with T4 (p<0,05). In all genes no significant differences were found between the subgroups (T2, T3, T4 stage, primary/recurrent lesion, non-keratinizing/keratinizing SCC, age before/ after 50, smokers/non-smokers) of the patients. Thus, changes in the expression of the CDO1 and WIF1 genes can affect mechanisms of the occurrence and development of HNSCC.

Background: Plasma levels of von Willebrand factor (VWF) are significantly elevated in patients with COVID-19. However, the dynamic changes and prognostic value of this biomarker in hospitalized patients with COVID-19 are not determined. Methods: 124 patients infected with SARS-CoV2 were prospectively recruited for the study. Serial blood samples were obtained at the time of admission (D1), 3-4 days following standard of care treatments (D2), and 1-2 days prior to discharge or death (D3). Plasma VWF antigen, ADAMTS13 antigen and activity, as well as the ratio of VWF/ADAMTS13 were determined, followed by statistical analyses. Results:While admission plasma levels of VWF in COVID-19 patients were significantly elevated, no statistical significance was detected among patients of different disease severity. Plasma ADAMTS13 activity, but not its antigen levels, were significantly lower in patients with severe or critical COVID-19 compared with other groups. Interestingly, the ratios of plasma VWF antigen to ADAMTS13 antigen were significantly higher in patients with severe or critical COVID-19 than in those with mild to moderate disease. More importantly, plasma levels of VWF and VWF/ADAMTS13 ratios were persistently elevated in patients with COVID-19 during hospitalization. Kaplan-Meier and Cox proportional hazard regression analysis revealed that an increased plasma VWF or ratio of VWF/ADAMTS13 at D2 and D3 associated with an increased mortality rate. Conclusions: Persistent endotheliopathy, marked by an elevated level of plasma VWF or an increased VWF/ADAMTS13 ratio, is present in all hospitalized patients following SARS-CoV2 infection and strongly associated with mortality.

Progress in macrophage research is crucial for numerous applications in medicine, including cancer and infectious diseases. However, the existing methods to manipulate living macrophages are labor intense and inconvenient. Here we show that macrophage membranes can be reconstituted after storage for months at 4C, with their CD206 receptor selectivity and specificity being similar to that in the living cells. Then, we have developed a mannose ligand, specific to CD206, linked with PEG as IR spectroscopy marker to detect binding with the macrophage receptor. PEG was selected due to its unique adsorption band of C-O-C group at IR spectra, which does not overlap with other biomolecule’s spectroscopic feature. Next, competitive binding assay versus the PEG-bound ligand, has enabled selection of other higher-affinity ligands specific to CD206. Further, those higher-affinity ligands were used to differentiate activated macrophages in patient’s bronchoalveolar (BAL) or nasopharyngeal (NPL) lavage. CD206- control cells (HEK293T) showed only non-specific binding. Therefore, biochips based on reconstituted macrophage membranes as well as PEG-trimannoside as an IR spectroscopic marker, can be used to develop new methods facilitating macrophage research and macrophage-focused drug discovery.

Nutrients are the driving force of plant and herbivore interactions. Different elements and fertilization levels in soil, or artificially fertilized substrates can have a direct impact on plant defense responses. Meanwhile, nutrient levels mediated by root associated microbes can indirectly affect plant-herbivore interactions. Nutrient uptake promoted by beneficial mycorrhizal fungi or rhizobacteria interacting with roots can stimulate plant tolerance to herbivore attack, as evidenced by herbivore performance, plant nutrient status, plant biomass allocation and compensatory growth. In return, herbivory affects nutrient fluxes between plants and their associated beneficial microbes. Furthermore, aboveground and belowground herbivory can affect the nutrient exchange between plants and soil microbial communities, mainly for carbon-and nitrogen-based resources supporting herbivores´ life cycles. These ecological interactions are governed by jasmonic acid (JA) and key enzymes on the molecular level. This review summarizes the current scientific literature on the role of nutrients in plant-herbivore interactions. This will support efforts to optimize plant defense strategy via managing nutrient variance.

Inflammatory Bowel Disease (IBD) is a chronic and progressive inflammatory disorder affecting the gastrointestinal tract (GT) caused by a wide range of genetic, microbial, and environmental factors. IBD is characterized by chronic inflammation, decreased gut microbial diversity and dysbiosis, with a lower amount of beneficial bacteria and a concomitant increase of pathogenic species. It is well known that dysbiosis is closely related to the induction of inflammation and oxidative stress, this last caused by an imbalance between reactive oxygen species (ROS) production and cellular antioxidant capacity that leads to cellular ROS accumulation. ROS are responsible for the intestinal epithelium oxidative damage and the increased intestinal permeability found in IBD patients and their reduction could represent a potential therapeutic strategy to limit the IBD progression and alleviate its symptom. Recent evidence highlighted that dietary polyphenols, natural antioxidants, are able to maintain redox equilibrium in the GT preventing gut dysbiosis, intestinal epithelium damage and radical inflammatory responses. Here, we suggest that the relatively new foodomics approaches, together with new technologies for promoting the antioxidative properties of dietary polyphenols, including novel delivery systems, chemical modifications and combination strategies, may provide critical insight to determine the clinical value of polyphenols for IBD therapy and a comprehensive perspective for implementing natural antioxidants as potential IBD candidate treatment.

Effective management of retinoblastoma (RB), the most prevalent childhood eye cancer, depends on reliable monitoring and diagnosis. A promising candidate in this context is the secreted trefoil family factor peptide 1 (TFF1), recently discovered as a promising new biomarker in patients with a more advanced subtype of retinoblastoma. The present study investigated TFF1 expression within aqueous humor (AH) of enucleated eyes and compared TFF1 levels in AH and corresponding blood serum samples from RB patients undergoing intravitreal chemotherapy (IVC). TFF1 was consistently detectable in AH, confirming its potential as a biomarker. Crucially, our data confirmed that TFF1 secreting cells within the tumor mass originate from RB tumor cells, not from surrounding stromal cells. IVC therapy responsive patients exhibited remarkably reduced TFF1 levels post-therapy. By contrast, RB patients` blood serum displayed low to undetectable levels of TFF1 even after sample concentration and no therapy-dependent changes were observed. Our findings suggest that compared to blood serum AH represents the more reliable source for TFF1 if used for liquid biopsy RB marker analysis in RB patients. Thus, analysis of TFF1 in AH of RB patients potentially provides a minimal invasive tool for monitoring RB therapy efficacy, suggesting its importance for effective treatment regimens.

The giant panda (Ailuropoda melanoleuca) is one of the most endangered species of land mammals and has significant academic research value worldwide. The evaluation of hematological parameters in giant pandas is important for assessing the physiological status of animals. This study collected blood samples from 12 healthy giant pandas from September 2018 to August 2020 under non-anesthetic conditions. The samples were then analyzed for basic blood indices and blood rheology, and normal values for hematological parameters and blood rheology under non-anesthetic conditions in giant pandas in Beijing area were obtained. The study confirmed the influence of age and season on hematological and biochemical parameters in captive giant pandas: hematological morphology, blood rheology, and serum enzymes showed seasonal variations, while age affected the changes in serum enzymes, serum protein content, and serum metabolite content. There are significant differences in blood indicators among different age groups of giant pandas, indicating variations in the overall metabolic processes and differences among pandas of different age groups. Seasonal variations showed a regulatory effect on blood rheology parameters and a negative effect on blood viscosity. Further research should be conducted to investigate whether factors such as season and climate cause environmental stress in captive giant pandas. The results obtained in this study aim to better protect the stability of the giant panda population and provide references for the appropriate feeding and medical care of captive giant pandas.

Neuronal PAS domain protein 2 (NPAS2) is a hemeprotein comprising a basic helix-loop-helix domain (bHLH) and two heme-binding sites, the PAS-A and PAS-B domains. This protein acts as a pyridine nucleotide-dependent and gas-responsive CO-dependent transcription factor and is encoded by a gene whose expression fluctuates with circadian rhythmicity. NPAS2 can heterodimerize with ARNTL in the activating limb of the transcriptional/translational feedback loop operating the circadian clock circuitry. NPAS2 can functionally substitute for the core transcription factor and histone/protein acetylase CLOCK in the molecular clockwork endowing central oscillators in the suprachiasmatic nuclei of hypothalamus as well as in peripheral oscillators in the cell of other body tissues, such as the liver and kidney.

A human brain can communicate with another one’s brain using quantum entanglement. Similar particles can entangle without interaction. Sensory communication between two individuals from far distances is still not known. Former studies primarily have been performed regarding brain neurons' quantum behavior. The test was performed on two individuals far from each other. These individuals were put under the same music on the basis of brain neuroplasticity property. By activating the brain reward system, aligned thinking was time scheduled in these individuals’ brains. On the basis of entanglement, compressed information was sent and received between these two individuals.

The potency and challenges of sorghum development in tidal swamplands in Indonesia have yet to be well studied. Our research was the first to evaluate land suitability, economic performance, and strategies for developing sorghum in tidal swamplands in Central Kalimantan. The assessment methods for the potency and utilization of sorghum used the land suitability evaluation method, gross margin and profit analysis, break-even, and competitive analysis. As a tool for decision-making, we used SWOT followed by the quantitative strategic planning matrix (QSPM) analysis. The results showed that the potency of arable land suitable for sorghum development was 578,511 ha. Economically, sorghum farming can generate an IDR 12,894,000 per ha with a revenue-cost ratio of 1.72; the break-even price was IDR 2,447 per kg, around 42% lower than the current market price. Sorghum was also more competitive than cassava, sweet potato, and soybeans (Q values of 0.76, 0.58, and 0.61, respectively) and less competitive than maize (Q = 1.33). Based on the QSPM, there were five alternative strategies for developing sorghum in tidal swamplands, i.e., (1) Optimization of productivity, (2) Improving the quality of human resources of farmers, (3) Facilitation of partnership cooperation, (4) Application of site-specific technology, and (5) Optimization of waste utilization. Those strategies show the potential expansion of sorghum planting in the tidal swamplands and the economic value enhancement for the community.

Burkholderia andropogonis is a severe plant pathogen that can infect more than 50 plant species. Although its genome has been sequenced and annotated, various mechanisms underlying its physiology and pathogenicity remain unknown. Some of these mechanisms can be uncovered through understanding its proteome. In this study, sodium dodecyl polyacrylamide gel electrophoresis (SDS-PAGE) and mass spectrometry analysis were used to profile the proteome of B. andropogonis. Exactly 538 proteins, which belong to 190 protein families performing 88 different functions were identified. The resulting STRING network analysis identified 28 proteins having highly connected interactions with adenosine triphosphate (ATP)-binding-cassette and (ABC) transport system. To the knowledge of the authors, this is the first comprehensive proteomic study on B. andropogonis.

In order to enhance understanding of RNA-binding proteins in rice, a comprehensive investigation was conducted on the RRM1 gene family of rice, encompassing genome-wide identification and exploration of its role in rice blast resistance. Physical and chemical properties of the OsRRM1 gene family in rice was analyzed, including conserved domain, motif, location information, gene structure, phylogenetic tree, collinearity analysis, cis-acting elements, GO, and KEGG. Furthermore, the expression patterns of the OsRRM1 gene were examined at different time intervals following rice blast treatment. Furthermore, the alterations in expression patterns of selected OsRRM1 genes were assessed using quantitative real-time PCR(qRT-PCR). A total of 212 members of the OsRRM1 gene family were identified, which were dispersed across 12 chromosomes. Many of these genes exhibit multiple exons and introns, all of which encompass the conserved RRM1 domain and share analogous motifs. This observation suggests a high degree of conservation within the encoded sequence domain of these genes. Phylogenetic analysis revealed the existence of five subfamilies within the OsRRM1 gene family. Furthermore, the investigation of the promoter region identified homeopathic elements that are involved in nucleic acid binding and interaction with multiple transcription factors. By employing GO and KEGG analysis, four RRM1 genes were tentatively identified as crucial contributors to plant immunity, while the RRM1 gene family was also found to have a significant involvement in the complex of alternative splicing. Additionally, gene expression analysis indicated that the majority of OsRRM1 genes exhibited constitutive expression. The results of the qRT-PCR analysis revealed distinct temporal changes in the expression pattern of the OsRRM1 gene following rice blast treatment. These findings contribute to the existing knowledge of the OsRRM1 gene family, establish a foundation for further investigation into the role of the OsRRM1 gene in response to rice blast infection, and hold theoretical significance for future studies on the functionality of the OsRRM1 gene.

In this report, we establish a straightforward method for estimating the equilibrium constant for the CK reaction over wide but physiologically and experimentally relevant ranges of pH, Mg2+ and temperature. Our empirical formula for CK Keq” is based on experimental measurements. It can be used to estimate [ADP] when [ADP] is below the resolution of experimental measurements, a typical situation because [ADP] is on the order of micromolar concentrations in living cells, and may be much lower in many in vitro experiments. Accurate prediction of [ADP] is essential for in vivo studies of cellular energetics and metabolism, and for in vitro studies of ATP-dependent enzyme function under near-physiological conditions. With [ADP], we could estimate ΔGATP. Application to actomyosin force generation in muscle provides support for the hypothesis that, when [Pi] varies but not when pH is altered, maximum Ca2+-activated isometric force depends on ΔGATP in both living and permeabilized muscle preparations. Further analysis of the pH studies introduces a novel hypothesis for the role of submicromolar ADP in force generation.

High Resolution Melting Analysis (HRM) has been pointed as a suitable alternative method to detect and identify Leishmania species. Herein, we aimed to evaluate the sensitivity, specificity, accuracy, and limitations of a HSP70-HRM protocol both as a diagnostic scheme applied in clinical samples and as a species typing tool for laboratory research and reference services. Our data reveal the pronounced species-typing potential of the HSP70-HRM in DNA from cultured parasites. For clinical samples, however, we advise caution due to the parasite load-dependent accuracy. In the light of these findings and considering the importance of parasite load determination for clinical and research purposes we recommend the integration of the presented typing scheme and the previously published Leishmania quantifying approach as combined tools for clinicians, surveillance, and research.

The life cycle of cancer follows the life cycle of the common ancestor of amoebozoans, metazoans, and fungi (AMF) and its systemic germline, which serves as a blueprint for all germlines capable of asymmetric cell division (ACD) and stem cell differentiation. Consequently, the oxygen sensitivity of the ancient non-gametogenic germline (Urgermline) was inherited by all germ and stem cell lines including the cancer germline. They all respond to Ugermline’s hyperoxia with loss of stemness and ACD ability and a dysregulated phenotype with irreparable DNA defects and defective symmetric cell divisions (DSCD). In protists, defective DSCD cells undergo an ancient MGRS repair program involving cell and nuclear fusion and hyperploid giant nuclei that restores the damaged genome to its former pre-DSCD state, with ACD potential and stemness. Human and metazoan DSCD use the same MGRS repair program inherited from the AMF ancestor. Ectopic DSCDs and DSCD-like phenotypes can survive in humans for many years in suitable niches. Under favorable environmental conditions, they also have access to the ancient MGRS repair mechanism including the ancient gene regulatory network (aGRN) and all other AMF genes. The aGRN takes control of cancer’s hybrid genome and represses human genes. It installs a G+S cancer life cycle of AMF imprinting that shapes the differentiation of naïve cancer stem cells (CSCs). CSCs are deeply homologous to the aGSCs of the AMF ancestor. Reprogramming of the DSCD genome by MGRS paves the way for oncogenesis. In this light, cancer is not a mutational or genetic disease, but a non-mutational genome-altering disease.

The Carbonic Anidrase isoform IX (hCA IX) is one of the main player in extracellular tumor pH regulation and it is known to be overexpressed in breast cancer as well as in many common tu-mors. hCA IX has shown to contribute to the growth and survival of tumor cells and its expres-sion is correlated to metastasis and resistance to therapies making it an interesting biomarker for diagnosis and potential image-guided therapy. The aim of this work is the development of an MRI Imaging probe able to target the extracellular non catalytic PG domain of CAIX. A new specific nano probe has been designed by conjugating a peptidic interactor of PG domain on the surface of a liposome loaded with Gd-based contrast agents. Mouse Mammary Adenocarcinoma Cell Line (TS/A ) has been chosen as in vitro breast cancer model to test the efficacy of the de-veloped probe. MRI results display a high selectivity towards hCA IX marker and a good sensi-tivity of the Imaging probe. These findings make this approach promising for future develop-ment of in vivo diagnostic protocols aimed at visualizing this enzyme expression.

Our previous retrospective observational study demonstrated the safety of laparoscopically assisted subtotal colectomy with ileorectal anastomosis and preservation of the superior rectal artery (SRA), without instances of leakage, in patients with slow-transit constipation (STC). Thus, we extended the enrollment period and enlarged the sample size to detect the differences in the post-operative complications, and surgical and functional outcomes between patients who underwent laparoscopically assisted subtotal colectomy with and without SRA preservation. We conducted a retrospective single-center analysis of patients with STC who underwent laparoscopically assisted subtotal colectomy between 2016 and 2020. The diagnosis of STC was based on the colonic transit and anal functional tests, and barium enema to exclude secondary causes. Patients were divided into group A that underwent surgery with SRA preservation, and group B that underwent ligation of the SRA during surgery. Outcome assessments for both groups included the incidence of anastomotic breakdown, intraoperative complications, length of hospital stay, estimated blood loss, time to first flatus, and complications. Propensity-score matching allocated 34 patients to groups A and B each. Postoperative bowel function, including time to first flatus, stool, and oral intake, recovered better in group A than that in group B. Anastomotic leakage, a significant postoperative complication, was less frequent in patients with SRA preservation. Preservation of the SRA in patients undergoing laparoscopically assisted subtotal colectomy with ileorectal anastomosis for STC is associated with favorable postoperative bowel function recovery and lower anastomotic leakage rates.

Rapeseed (Brassica napus L.) is one of the most important oil crops in China. Improving oil production of rapeseed is an important way to ensure the safety of edible oil in China. Oil production is an important index to reflect the quality of rapeseed and is determined by oil content and yield. Applying nitrogen is an important way to ensure a high yield. However, increasing nitrogen application would decrease oil content. Thus, it is critical to screen elite germplasm resources with stable or improved oil content under high nitrogen and to investigate the molecular mechanisms of nitrogen regulation of oil accumulation. In this paper, we review the effects of nitrogen levels on rapeseed yields and oil content, aiming to reveal the mechanisms of nitrogen regulation in oil accumulation and thereby provide a theoretical basis for breeding varieties with high oil content.

The application of melatonin (MT) has been shown to improve the quality during the storage of fruits and vegetables. The primary objective of this study is to investigate the effects of MT on the quality of fresh-cut Gastrodia elata during low temperature (4°C) storage. The results indicate that MT treatment could suppress the respiratory rate and malondialdehyde content of fresh-cut G. elata, while also slowing down the decline in total acidity and total soluble solids. The treatment with MT reduced the superoxide anions and hydrogen peroxide production, inhibited the activity and expression of peroxidase and polyphenol oxidase. Additionally, it led to increased activity and expression of antioxidant-related enzymes, including superoxide dismutase, catalase, ascorbate peroxidase, glutathione reductase, monodehydroascorbate reductase, and dehydroascorbate reductase, while also resulted in elevated levels of ascorbic acid and glutathione. Furthermore, the treatment with MT induced an increase in total phenolic and flavonoid content of fresh-cut G. elata and enhanced the activity and expression of key enzymes involved in phenylpropanoid pathway (phenylalanine ammonia-lyase, cinnamate-4-hydroxylase, 4-coumarate: CoA ligase). In summary, MT enhances the antioxidant capacity by activating both ROS metabolism and phenylpropanoid pathway, thus maintaining the quality of fresh cut G. elata.

Artemia (brine shrimp), holds significant value as a live feed for larval fish and crustaceans, owing to their distinctive dietary requirements. However, it is vital to acknowledge that Artemia also carries potential risk as a vector of infection. We conducted a metagenomic analysis to explore the virome present in Artemia cysts collected from inland salt lakes across four distinct regions in Kazakhstan. The study identified the presence of dsDNA phages and RNA virus sequences, with a predominant representation from the Reoviridae, Nodaviridae, Dicistroviridae, Picornaviridae, Astroviridae, Tombusviridae, and Solemoviridae families. In general, this study has significantly enhanced our understanding of the virome of Artemia cysts in the saline lakes of Kazakhstan. It has also furnished crucial insights for the identification, surveillance, and management of viral infections that impact brine shrimp and fish species populations.

Aberrant expression of the tight junction protein claudin 6 (CLDN6) is a hallmark of gastric can-cer progression. Its expression is regulated by the transcription factor CREB. But in H. pylo-ri-induced gastric cancer there is no information regarding what transcription factors in-duce/upregulate the expression of CLDN6. We aimed to identify if CREB and YY1 regulate the expression of CLDN6 and the site where they bind to the promoter sequence. Bioinformatics analysis, H. pylori LPS, YY1 and CREB silencing, western blot, luciferase assays, and chromatin immunoprecipitation experiments were performed using the gastric adenocarcinoma cell line AGS. A gen reporter assay suggested that the initial 2000 bp contains the regulatory sequence as-sociated with CLDN6 transcription; the luciferase assay demonstrated three different regions with transcriptional activity, but the -901 to -1421 bp region displayed the maximal transcrip-tional activity in response to LPS. Fragment 1279-1421 showed CREB and surprisingly YY1 oc-cupancy. Sequential ChIP experiments confirmed that YY1 and CREB interact in the 1279-1421 region. Our results suggest that CLDN6 expression is regulated by the binding of YY1 and CREB in the 901-1421 enhancer in which a non-described interaction of YY1 with CREB was established in the 1279-1421 region.

cGAS is a cytosolic DNA sensor that activates innate immune responses through production of the second messenger 2’3’-cGAMP, which activates the adaptor STING. cGAS senses dsDNA in a length-dependent but sequence-independent manner, and it cannot discriminate self-DNA from foreign DNA. In normal physiological conditions, cellular DNA is sequestered in the nucleus by nuclear envelope and in mitochondria by mitochondrial membrane. When self-DNA leaks into the cytosol during cellular stress, or during mitosis, the cGAS can be exposed to self-DNA and be activated. Recently, many studies have investigated how cGAS keeps inactive and avoids to be aberrantly activated by self-DNA. Thus, the aim of this narrative review is to summarize the mechanisms by which cGAS avoids to sense self-DNA under normal physiological conditions.

Male infertility is a condition that has always been less studied and known than female infertility. Male infertility is increasingly present and increasingly dignosticated. Although several causes are known, to date about 40% of the causes are considered idiopathic. The worldwide denatality, can only be slowed if awareness campaigns are implemented on all the diseases that can alter fertile potential, especially in young adolescents. Male infertility is, in addition, associated with several medical conditions, in particular the association between infertility and testicular cancer, cardiovascular disease, autoimmune diseases and genetic diseases is well known. For this reason, fertility preservation should not be proposed or be only oncological in nature, but there are several diagnosable pediatric pathologies associated with altered fertile potential to whose patients we could offer a gamete preservation pathway. In this paper we propose our experience on fertility preservation in pediatric andrological diseases.

Inosine 5'-monophoaphate (IMP) allows animals to sense umami. Intake of IMP in C57/KsJ-db/db (db/db) mice induced lipohyperplasia causing the liver cirrhosis, however, how to that of in normal mammals injure health is still unclear. Thus, we had investigated that intake of IMP in C57BL/6J mice effected its metabolic functions. We found that intake of 255 M/d IMP in C57BL/6J mice for 4 months induced hyperlipidemia and body fat rate raised. In mechanism, the expressions of ACC1 and phosphorylated ACC2 in hepatocytes were increased though IMP promoting phosphorylation of AMPK. The increased ACC1 promoted the conversion of acetyl-CoA into TG. These TG were transported out of hepatocytes to avoid NAFLD, causing a deficiency of acetyl-CoA in liver, and then the increased phosphorylated ACC2 promoted cytoplasm fatty acids into mitochondria to convert into acetyl-CoA though the fatty acids β-oxidation pathway, causing a deficiency of fatty acids. Therefore, liver enhanced the absorption of exogenous fatty acids, which were converted into TG caused lipohyperplasia. Moreover, intake of IMP in normal mice induced complement system weaken in liver causing mild inflammation. Our data not only alerted that humans avoid excessive intake of IMP, but also provided novel insights into the adipose of metabolic dysfunctions.

The accumulation of loss of function mutations in the uricase gene well explains the high urate levels in hominoids (apes and humans) compared to other mammals. The loss of human uricase activity may have allowed humans to survive environmental stressors, evolution bottlenecks, and life-threatening pathogens. While high urate levels may contribute to developing cardiometabolic disorders such as hypertension and insulin resistance, low urate levels may increase the risk for neurodegenerative diseases. The double-edged sword effect of uric acid has resurrected a growing interest in the antioxidant role of urate and the role of the uricase gene in modulating the risk of obesity. Characterizing both the effect of uric acid levels and the uricase gene in different animal models may provide new insights into the potential therapeutic benefits of uric acid and novel uricase-based therapy.

AlphaFold is a groundbreaking Deep Learning tool for protein structure prediction. It achieved remarkable accuracy in modeling the many 3D structures while taking as the input only the known amino acid sequence of proteins in question. Intriguingly though, in the early steps of each individual structure prediction procedure, AlphaFold is not respecting topological barriers that in real proteins result from the reciprocals impermeability of polypeptide chains. This study aims to investigate how this non-respecting of topological barriers affects AlphaFold predictions with respect to the topology of protein chains. We focus on such classes of proteins that during their natural folding form reproducibly the same knot type on their linear polypeptide chain as revealed by their crystallographic analysis. We use partially artificial test constructs in which the mutual non-permeability of polypeptide chains should not permit the formation of such knots during natural protein folding. We find that despite the formal impossibility that the protein folding process could produce such knots, AlphaFold predicts these proteins to be knotted. Our study underscores the necessity for cautious interpretation and further validation of topological features in protein structures predicted by AlphaFold.

As mitochondria are negatively charged organelles, penetrating cations are used as a part of the chimeric molecules to deliver the specific compounds into mitochondria. However, unmodified penetrating cations affect different aspects of cellular physiology as well. In this review we have attempted to summarize the data about side effects of the commonly used natural (e.gberberine) and artificial (e.g. tetraphenylphosphonium, rhodamine, methylene blue) penetrating cations on cellular physiology. For instance, it was shown that such types of molecules can (1) facilitate proton transport across membranes; (2) react with redox groups of respiratory chain; (3) induce DNA damage; (4) interfere with pleiotropic drug resistance; (5) disturb membrane integrity (6) inhibit the enzymes. Also, the products of the biodegradation of penetrating cations can be toxic. As penetrating cations accumulate in mitochondria, their toxicity is mostly due to the mitochondrial damage. Mitochondria of certain types of cancer cells appear to be especially sensitive to penetrating cations. Here we discuss the molecular mechanisms of the toxic effects and the anti-cancer activity of the penetrating cations.

This paper proposes a reconceptualization of the hierarchical understanding of the human organism, challenging the conventional idea of the supremacy of the nervous system. We argue that symbiotic coexistence and functional interdependence among all systems provide the human body with remarkable resistance to the universal tendency of entropy. We first examine the basis of cellular life, referring to ATP and DNA, essential substances that resist the entropic tendency through complex energy mechanisms. Next, we analyze the collaboration between the body's systems, highlighting the critical role of erythrocytes, which constitute 83.9% of the total cells (24.9 trillion), in the context of energy maintenance and homeostasis. We challenge the conventional view that the nervous system, composed of neurons and glial cells, which together make up 0.6% of the total cells (0.17 trillion), occupies the apex of a biological hierarchy, arguing that the nervous system is merely a component of a broader, interdependent mechanism. Finally, we provide a detailed description of human cellular composition, emphasizing the importance of each cell type in the functional context, thus contributing to the totality of the organism. With this, we present a vigorous appeal for the realization of critical reassessments of fundamental premises in human biology.

Non-ulcerated cutaneous leishmaniasis (NUCL) is an atypical and peculiar clinical form of the disease that was first described by Ponce et al. (1988) in Honduras (Central America), where iso-lated or disseminated popular and/or nodular skin lesions are commonly seen in adolescents and young adults. Leishmania (L.) chagasi was then incriminated as the causal agent of the disease, as well as of American visceral leishmaniasis (AVL), although NUCL has been shown to be more prevalent than AVL in the region. Considering, however, the dubious taxonomic character of the causal agent of NUCL, as there is no evidence of this form of disease associated with L. (L.) cha-gasi in South America, this study aimed to carry out a retrospective taxonomic analysis on a se-ries of studies on the diagnostic approach to the Honduran parasite in loco (El Tigre island, Amapala municipality, west coast of Honduras), where taxonomic characters of a biological (in vitro and in vivo), epidemiological (vector and canine reservoir), clinical-immunological (im-munopathological features of in situ skin lesion and systemic infection) and molecular (ge-nomic/phylogenetic analyses) nature were considered. The findings, particularly those of mo-lecular nature, such as: the Honduran parasite showed to be more ancestral (molecular clock analysis of the DNA polymerase alpha subunit gene) than all viscerotropic ones [L. (L.) chagasi, L. (L.) donovani and L. (L.) infantum], as well as presenting an absolutely unprecedented structural variation on chromosome 17 and the highest frequency of genomic SNPs (more than twice the number seen in the Brazilian parasite), in addition to representing a different phylogenetic lin-eage (mainly in the NJ - RNA Pol II tree) from those viscerotropic ones, have pointed to the characterization of a new leishmanine parasite, Leishmania (Leishmania) poncei n. sp. (Kinetoplas-tea: Trypanosomatidae), in honor of Professor Ponce, who was the first researcher to describe NUCL in Honduras.

The present study aimed to develop a feeding strategy for pregnant sows which involved the prenatal administration of a mixture of pancreatic-like fungal enzymes, such as lipase, amylase, and protease, at (1) 1–115 days of gestation (group D1) and (2) 80–115 days of gestation (group D2) and to carry out a comparison with groups of sows that were not receiving such supplementation (negative control [NC] and positive control [PC]). It was found that the administration of the enzyme supplement resulted in a significant shortening of gestation (P ≤ 0.01). The pancreatic enzymes administered to sows had a significant effect on the number of liveborn piglets and weaned piglets, which was higher compared to the control groups that did not receive supplementation respectively: D1-12.1±1.1 and 11.12±1.1; D2- 12.8±1.3 and 11.75±0.07 vs. control groups KN-10.7±1.0 and 9.62±0,95 and KP 10.9±1.2 and 10.15±1.0 (P<0.006). Significant changes in piglet growth were observed after weaning up to 70 days of age. During this period, the most favorable growth parameters were found in groups D2 (420±91g) and PC (407±103g), in which piglets were given a mixture of pancreatic enzymes (lipase, amylase, and protease) at 3 weeks of age, and significantly higher weight gain and feed intake were observed compared to groups NC (378±114g) and D1 (381±96g) (P ≤ 0.007). In contrast, insulin levels were significantly lower in groups D1 and D2, respectively 6,8 IU/ml and 6,7 IU/ml compared to groups NC (14,6 IU/ml) and PC (16,6 IU/ml) ( (P ≤ 0.01). Piglets in group D2 had a significantly better feed conversion ratio (FCR) 1.604±0.10 compared to the other dietary groups: KN– 1.986±0.14; KP– 1.704±0.11; D1 – 1.932±0.15 (P ≤ 0.03). Histological imaging confirmed significantly thicker intestinal epithelium and intestinal mesenteron in animals from groups D2 and PC (P ≤ 0.03). Animals from the groups KP, D1 and D2 receiving enzymes showed a highly significant increase in the surface area of pancreatic follicles and pancreatic surface area compared to the group without KN supplementation (P<0.01). Furthermore, significantly higher activity of the brush border enzyme lactase was observed in groups D1; D2 and PC compared, respectively 32.90±3.99; 30.00±6.83 and 29.60±29.60 to group NC – 21.80± 3.27 (P ≤ 0.01).

Peste des Petits Ruminants (PPR), a highly contagious viral disease, causes significant economic losses in sheep and goats. Laboratory diagnosis is crucial to disease control and eradication. Since PPRVs have recently adopted new hosts, genetic diversity within isolates of the same lineage is more likely than if they were host-specific, sheep and goats most often. ELISA detects antibodies and antigens in serology. However, mishandling, environmental conditions (temperature and humidity), storage, and sensitivity issues of commercially available ELISA kits prevent rapid PPR virus detection in third-world countries like Pakistan. In the 2020-21 outbreaks in Pakistan, 325 blood samples, 19 swabs, and 6 virus tissue samples of sheep and goats were collected from Gilgit, Islamabad, and Fateh Jang. These virus isolates were submitted to NCBI for partial N gene sequencing. Antigen was prepared from indigenous virus Using semi-purified antigen from PPRV, an indirect ELISA for the detection of PPR antibodies in goat and sheep serum was developed using MW600922 grown in Vero cells. Dilutions of 1:200 serums and 1:32 antigens improve antibody detection. The N-gene-based analysis revealed a better understanding of PPRV genetic characterization. This study develops an RT-PCR assay to detect PPRV by targeting the N-protein gene. This assay offers an accurate and affordable diagnostic tool for PPRV and partial genome sequencing. Results described that PPRV isolates from the current study have 99.73% and 99.4% similarity to previously published Lahore and Faisalabad isolates from Pakistan, respectively. Compared to previous isolates from NCBI data, the virus showed high divergence rates with the Turkish strain. The comparative analysis between Commercial kit (c-ELISA) and I-ELISA revealed that the former had a high sensitivity of 90.60% and specificity of 85.23% compared with the cELISA kit. By comparing I-ELISA and VNT, we find that the current assay is 100% specific and 82.14 % sensitive. Based on these results, serological surveys for PPR antibodies, on a larger scale, in small ruminants can be conducted with indirect ELISA rather than competitive ELISA. Furthermore, the cost and storage efficiency was highly significant because the currently developed method has a low production cost, which is much lesser than the commercially available kit. Our findings demonstrated a significant breakthrough in terms of cost-effectiveness and storage efficiency, and they are highly recommended for developing countries.

Plasminogen (Plg) is the inactive form of plasmin (Plm) that exists in two major glycoforms, referred to as glycoforms I and II (GI and GII). In the circulation, Plg assumes an activation-resistant 'closed' conformation via interdomain interactions and is mediated by the lysine binding site (LBS) on the kringle (KR) domains. These inter-domain interactions can be readily disrupted when Plg binds to lysine/arginine residues on protein targets or free L-lysine and analogues. This causes Plg to convert into an 'open' form which is crucial for activation by host activators. In this study, we investigated how various ligands affect the kinetics of Plg conformational change using small-angle X-ray scattering (SAXS). We began by examining the open and closed conformations of Plg using size-exclusion chromatography (SEC) coupled with SAXS. Next, we developed a high throughput (HTP) 96-well SAXS assay setup. This method enables us to determine the Kopen value, which is used to compare ligands’ effect on Plg conformation directly. Based on our analysis using Plg GII, we have found that the Kopen for ε-aminocaproic acid (EACA) is approximately three times greater than that of Tranexamic acid (TXA), which is widely recognized as a highly effective ligand. We demonstrated further that Plg undergoes a conformational change when it binds to the C-terminal peptides of the inhibitor α2-antiplasmin and receptor Plg‑RKT. Our findings suggest that, besides the C-terminal lysine, internal lysine(s) are also necessary for the formation of open Plg. Finally, we compared the conformational changes of Plg GI and GII directly and found that the closed form of GI, which has an N-linked glycosylation, is less stable. To summarize, we have successfully determined the response of Plg to various ligand/receptor peptides by directly measuring the kinetics of its conformational changes.

This study represents the first to examine the nutritional status of Moroccan football players. The aim of this research is to assess the energy and macronutrient intake of professional players from a club competing in the Moroccan professional league "Botola-Pro." Moreover, the study tries to find the potential correlation between nutritional intake and physical performance. A total of 27 professional players participated in a seven consecutive-day study, during a microcycle of the preseason period. The dietary intake was evaluated using the self-reported, complemented by a 24-hour recall. The InBody 120 bioelectrical impedance was employed for assessing body composition measurements, while the Yo-Yo test was utilized to evaluate physical performance; which estimates the maximal oxygen consumption level (VO2max). Among these players, their protein intake levels aligned with recommendations (1.6 to 2.2 g/kg of Body Mass). On the other hand, fat intake slightly surpassed the recommended values. However, carbohydrate intake was relatively subdued compared to recommendations of the Union of European Football Associations (UEFA) in the pre-season training phase. A positive correlation was observed (P-value of &lt; 0.001 and R=0.831) between carbohydrate intake and the measure of VO2max. This suggests that an increase in carbohydrate consumption is associated with enhanced performance, especially within the range of 6 to 8 g/kg BM per day. Conversely, a negative correlation was identified (P-value of &lt; 0.01 and R= − 0.847) between the percentage of dietary fat and the VO2max. The findings of this study highlight areas of nutrition that could be enhanced among professional football players to optimize their performance. In effect, nutritional education is necessary for this category of athletes. Thus, an individual care approach is strongly recommended.

Hepatocellular Carcinoma (HCC) continues to pose a substantial global health challenge due to its high incidence and limited therapeutic options. In recent years, the Janus Kinase (JAK) and Signal Transducer and Activator of Transcription (STAT) pathway has emerged as a critical signaling cascade in HCC pathogenesis. The review commences with an overview of the JAK/STAT pathway, delving into the dynamic interplay between the JAK/STAT pathway and its numerous upstream activators, such as cytokines and growth factors enriched in pathogenic livers afflicted with chronic inflammation and cirrhosis. This paper also elucidates how the persistent activation of JAK/STAT signaling leads to diverse oncogenic processes during hepatocarcinogenesis, including uncontrolled cell proliferation, evasion of apoptosis, and immune escape. In the context of therapeutic implications, this review summarizes recent advancements in targeting the JAK/STAT pathway for HCC treatment. Preclinical and clinical studies investigating inhibitors and modulators of JAK/STAT signaling are discussed, highlighting their potential in suppressing the deadly disease. The insights presented herein underscore the necessity for continued research into targeting the JAK/STAT signaling pathway as a promising avenue for HCC therapy.

The availability of multiple sequenced genomes from a single species made it possible to explore intra- and inter-specific genomic comparisons at higher resolution and build clade-specific pangenomes of several crops. The pan-genomes of crops constructed from various cultivars/accessions, landraces, and wild ancestral species represent a compendium of genes and structural variations and allow researchers to search for the novel genes and alleles that were inadvertently lost in domesticated crops during the historical process of crop domestication or in the process of extensive plant breeding. Fortunately, many valuable genes and alleles associated with desirable traits like disease resistance, abiotic stress tolerance, plant architecture, and nutrition qualities exist in landraces, ancestral species, and crop wild relatives. The novels genes from the wild ancestors and landraces can be introduced back to high-yielding varieties of modern crops by implementing classical plant breeding, genomic selection, and transgenic/gene editing approaches. Thus, pan-genomic represents a great leap in plant research and offers new avenues for targeted breeding for mitigating the impact of global climate change. Here we summarize the tools used for pangenome assembly and annotations, web-portals hosting plant pangenomes. Furthermore, we highlight a few discoveries made in crops using the pan-genomic approach and its future potential.

Background: The mechanisms underlying the effect of estradiol (E2) on low-density lipoprotein cholesterol (LDL-C) levels are not completely understood, although a role for proprotein con-vertase subtilisin/kexin type 9 (PCSK9) has been proposed. We aimed to investigate the association between levels of E2, PCSK9 and lipid parameters in premenopausal women undergoing in vitro fertilization (IVF). Methods: Healthy women undergoing IVF in the Department of Obstetrics and Gynecology of the University General Hospital of Ioannina were recruited. Levels of E2, pro-protein convertase subtilisin/kexin type 9 (PCSK9), total cholesterol (TCHOL), high-density lip-oprotein cholesterol (HDL-C), LDL-C, and triglycerides (TGs) were measured 10 days after ovarian depression (E2min) and 7 days after ovarian stimulation (E2max). Results: A total of 34 consecutive healthy women aged 38 (26-46) years old who underwent a full IVF cycle were included. E2 levels increased by 329.6% from E2min to E2max (108 [47-346] to 464 [241-2471] pg/mL, p<0.05). At the same time, serum PCSK9 levels significantly decreased by 30.8% (245 ± 80 to 170 ± 64 ng/mL, p<0.05). No significant changes in TCHOL, LDL-C, TGs and HDL-C were found (-0.4%, -3.8%, -2.2%, and +5.3%, p >0.05). Conclusions: The increase in endogenous E2 production during an IVF cycle was associated with a significant decrease in serum PCSK9 levels during a 7-day period.

Rabies is one of the most significant public and veterinary health problem, causing ap-proximately 59 000 human deaths annually in the developing countries of Asia and Afri-ca. The aetiologic agent, a viral species of the Lyssavirus genus, is highly neurotropic and has a wide host range including terrestrial mammals and several Chiropteran species. The Lyssavirus mokola (MOKV) was first isolated in the late 1960s from organ pools of shrews (Crocidura flavescens manni) in the Mokola forest (Nigeria). To date, at least 30 MOKV isola-tions have been confirmed, all exclusively from Africa, with 73% from southern Africa. There is a limited knowledge about the epidemiology of MOKV and the reservoir host spe-cies is unknown. Here we report on a retrospective identification of a new MOKV from Eswatini, based on molecular characterization of rabies viruses originating from both domestic and African wild cats. A partial region of the lyssavirus genome, encoding the nucleoprotein, was amplified and sequenced. Nucleotide sequence analysis retrospec-tively identified a rare lyssavirus, a Lyssavirus mokola from a domestic cat from Eswatini, whilst the majority of the lyssaviruses were identified as Lyssavirus rabies (98%). Further-more, the nucleotide sequence divergence between the recently identified MOKV isolate, and the historical Lyssavirus mokola isolates ranged from 6.8% and 8.3%. This study further highlights the association between the potential host species of Lyssavirus mokola and the domestic cat as an incidental host. Therefore, continuous vaccination of domestic cats against rabies is crucial even after the elimination of dog-mediated rabies as spill-over re-lated to sylvatic rabies cycles is likely to occur.

Multiple myeloma (MM) has witnessed improved patient outcomes through advancements in therapeutic approaches. Notably, allogeneic stem cell transplantation, proteasome inhibitors, immunomodulatory drugs, and monoclonal antibodies have contributed to enhanced quality of life. Recently, a promising avenue has emerged with chimeric antigen receptor (CAR) T cells targeting B-cell maturation antigen (BCMA), expressed widely on MM cells. To mitigate risks associated with allogenic T cells, we investigated the potential of BCMA CAR expression in natural killer cells (NKs), known for potent cytotoxicity and minimal side effects. Using the NK-92 cell line, we co-expressed BCMA CAR and soluble tumor necrosis factor-related apoptosis-inducing ligand (sTRAIL) employing the PiggyBac transposon system. Engineered NK cells (CAR-NK-92-TRAIL) demonstrated robust cytotoxicity against a panel of MM cell lines and primary patient samples, outperforming unmodified NK-92 cells with a mean difference in viability of 45,1% (± 26,1%, depending on the target cell line). Combination therapy was explored with the proteasome inhibitor bortezomib (BZ) and γ-secretase inhibitors (GSI), leading to a significant synergistic effect in combination with CAR-NK-92-TRAIL cells. This synergy was evident in cytotoxicity assays where a notable decrease in MM cell viability was observed in combinatorial therapy compared to single treatment. In summary, our study demonstrate the therapeutic potential of the CAR-NK-92-TRAIL cells for the treatment of MM. The synergistic impact of combining these engineered NK cells with BZ and GSI supports further development of allogeneic CAR-based products for effective MM therapy.

Durum wheat is an economically and nutritionally important cereal. The increase in durum wheat yield is mostly associated with improving grain traits. The grain size and shape-related traits are directly related to wheat yield. In addition, grain size influences the seed germination rate and seedling vigour, which play key roles in stand establishment and yield. Thus, it is important to investigate grain traits both agro-morphologically and genetically. In this study, a panel of durum wheat, consisted of 146 genotypes, was evaluated for grain traits agro-morphologically, and a genome-wide association study (GWAS) was conducted to dissect the genomic regions associated with these traits. As a result of GWAS, a total of 41 marker-trait associations (MTAs) were identified on different chromosomes of durum wheat. Of these MTAs, only 11 were stable across environments. A BLAST search for flanking sequences of every stable MTAs in the Svevo genome identified 18 putative candidate genes directly associated with seed traits of different plants, particularly wheat seeds. In conclusion, the annotation results and literature information provide strong evidence that identified stable MTAs and their candidate genes may have important functions in the formation of wheat grain traits. After the validation of these MTAs with different fine-mapping and functional characterization studies, these loci may provide valuable information for geneticists and breeders to improve wheat yield.

To map Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV 2) spreading and evaluate immune responses variations against this virus, it was essential to locally set up efficient serological tests. The SARS-CoV2 immunogenic proteins were very expensive and not affordable mainly for Low and Middle Income Countries (LMICs). For this purpose, the commonly used antigen, Re-ceptor-Binding Domain (RBD) of Spike S1 protein (S1RBD), was produced using the the Baculovirus Expression Vector System (BEVS) . During the current study, the expression of S1RBD was monitored using western blot under different culture conditions. Different parameters were studied: Multiplicity Of Infection (MOI), cell density at infection and harvest time. Hence, optimal conditions for efficient S1RBD production were identified: MOI 3; cell density at infection 2-3x 106 cells/mL and time post-infection (tpi or harvest time) of 72h and 72-96 h successively for expression in shake-flasks and 7L-bioreactor. A high production yield of S1RBD varying between 4mg and 70 mg per liter of crude cell culture supernatant was achieved, respectively, in shake-flasks and in 7L-bioreactor. Moreover, the produced S1RBD showed an excellent antigenicity potential against COVID-19 patient sera evaluated by western blot. Thus, additional serological assays, such as ELISA, were developed using the purified S1RDB (published by other research groups).